1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goryan [66]
3 years ago
13

Negative aspects of political parties include a. party labels that give information about a candidate's opinions b. educating th

e public about important issues c. governing in their own interests rather than the public interest d. the organization of Congress around committees
Biology
1 answer:
krek1111 [17]3 years ago
3 0

C) governing in their own interests rather than the public interest

Hope this helps chu

Have a great day

You might be interested in
1. Cytokinesis in plant cells result in the formation of a cell plate between the new cells , while cytokinesis in animal cells
Stella [2.4K]

Answer:

Yes it is right

Explanation:

8 0
3 years ago
What is the name for the type of white blood cell that produces antibodies that help the body fight infection? A. antibodies B.
Scorpion4ik [409]
D.    Hope this helped. :D  
4 0
3 years ago
When ATP breaks off the third phosphate group, it is converted into __________.
jasenka [17]
I think its ADP because it breaks off the third phosphate. 
4 0
3 years ago
Read 2 more answers
What is epinephrine and what function does it have?
jek_recluse [69]
It is a catecholamine. It is also known as adrenaline. It will increase the heart rate and other flight or fight responses.
3 0
3 years ago
A 35 year old woman is at the clinic for a gynecologic examination. during the examination she asks the nurse how often do i nee
nataly862011 [7]
The answer is D)

<span>After age 30, if you have 3 consecutive normal Pap tests, then you may be screened every 2 to 3 years.</span>
7 0
3 years ago
Other questions:
  • Which fungi has a positive and negative mating strands
    11·1 answer
  • What kind of chemical bonds are found between paired bases of the dna double helix?
    9·1 answer
  • What are the special adaptations needed for life on land?
    8·1 answer
  • What’s the answer for this
    9·1 answer
  • Do the Three Energy Systems work independently of each other; or do they overlap with one another, each one contributing to diff
    12·1 answer
  • In general, researchers indicate that genes that affect energy balance in the body appear to be very efficient as a means to pro
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Bioethanol is an example of plants being used for what function?
    7·1 answer
  • What is the difference between the smooth and rough Endoplasmic Reticulum?
    9·1 answer
  • Which illustration depicts homologous chromosomes?<br> Will give brainliest.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!