Your outer skin is your epidermis, so just look at your arm
Hihi!
The correct answer is B) non-living things in an environment! As for abiotic factors those are the livings things in an environment!
I hope I helped!
-Jailbaitasmr
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
"T" X "t" yields offspring that are all heterozygous with genotype "Tt"
Explanation:
An Allele refers to either of a pair of contrasting genes.
So, "TT" being the same yeild just one allele (T), while "tt" also yield one allele (t)
So, the cross of the both alleles
"T" X "t"
yields offspring that are all heterozygous with genotype "Tt"
Thus, the crossing dominant tall plant height "TT" and recessive short plant height "tt" yielded heterozygous tall plants "Tt"