1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
attashe74 [19]
3 years ago
7

When skeletal muscles contract such that bone segments move closer together, this action is known as: _______

Biology
1 answer:
zlopas [31]3 years ago
8 0

Answer:

"flexion"

Explanation:

According to my research on studies conducted by medical professionals, I can say that based on the information provided within the question this action is known as "flexion". Like mentioned in the question this is defined as the movement by which the bones or other parts of the body approach each other in the anti-posterior direction, parallel to the sagittal plane.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

You might be interested in
Can someone please help me with this pleaseeee!!! 32 points and i'll mark brainliest!!
ivanzaharov [21]

Answer:

IF you dont mark as brainlest im reporting you, heres the answer

Explanation:

Matter cannot be created in chemical reactions, so this is a conversation of mass. In the chemical reaction must end up in the products it started with.

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
PLS SOMEONE!!! ILL GIVE BRAINLIEST!! HELP
zhenek [66]

Answer:

A or 3 (Wether wich one is on your test) I TOOK THE TEST

Ill take brainliest

100% Verified

Explanation:

i took the test :D

8 0
3 years ago
I've been stuck on this question for quite a while now need some help best if I can get an answer with explanation
mart [117]

Answer:

B is most probably the right answer since it has the both hydrophollic and characteristics.

Not 100% sure though

4 0
3 years ago
Every living organism has what classification groups as its name?
Mariana [72]
A Kingdom. There's an animal and a plant Kingdom.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Why is natural selection, as a scientific model, applied at the population level and NOT at the individual level?
    5·1 answer
  • A researcher finds that blood alcohol levels cause progressive damage to the liver. All the mice in his study were fed the same
    12·1 answer
  • How do the quantities compareof ATP formed during aerobic and anaerobic respiration?
    12·1 answer
  • Written response (answer with a paragraph): Explain how the functionalist perspective and the conflict perspective view the phen
    15·1 answer
  • Crucigrama de los huesos porfavor necesito respuesta
    6·1 answer
  • ___________secrete histamine and heparin, and constitute less than 1% of all white blood cells.
    6·1 answer
  • How would the shape of a plant cell be different to a epithelial cheek cell
    14·1 answer
  • Can someone help me out with brainless to the correct answer please hurry I really need this ​
    9·1 answer
  • a regular solid has dimensions of 3.20 cm by 4.90 cm by 5.40 cm. the mass of the solid is 235g. what is its density in g/cm3​
    12·1 answer
  • The equation for photosynthesis?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!