The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
The answer would be shark i think
Answer:
In a slightly different way each time
Explanation:
Apex
Answer:
A) Reaction X used a catalyst
Explanation:
Reaction X has a lower activation energy and the most likely cause of this would be a catalyst.
The type of reproduction that takes place in archaebacteria and eubacteria is Binary Fission.
