1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
3 years ago
13

Small, accessory chromosomes found in bacteria that are useful in recombinant dna procedures are called

Biology
1 answer:
sergij07 [2.7K]3 years ago
5 0
They are called plasmids 
You might be interested in
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
konstantin123 [22]
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



3 0
3 years ago
What can eat a rainwater killifish?
dezoksy [38]
The answer would be shark i think

3 0
4 years ago
Random chance is an important part of a simulation because it is a way to
Bas_tet [7]

Answer:

In a slightly different way each time

Explanation:

Apex

7 0
4 years ago
Read 2 more answers
It says “Reaction Progression” on the bottom of the graph but I couldn’t fit it in the picture.
Lesechka [4]

Answer:

A) Reaction X used a catalyst

Explanation:

Reaction X has a lower activation energy and the most likely cause of this would be a catalyst.

7 0
3 years ago
Type of reproduction takes place in archaebacteria and eubacteria
Bond [772]
The type of reproduction that takes place in archaebacteria and eubacteria is Binary Fission.
4 0
4 years ago
Read 2 more answers
Other questions:
  • What is the function of a cell's selectly permeable membrane
    9·1 answer
  • Each kingdom has unique characteristics.
    7·1 answer
  • Noah wants to show the largest source of carbon on Earth for his school project. According to his research, and which form is mo
    6·1 answer
  • Question 12
    15·1 answer
  • As a ribosome moves along the messenger rna molecule
    8·1 answer
  • A protein contains 131 amino acids. How many bases will there
    11·1 answer
  • How does the mantle interact with the crust at a subduction zone? A. Plates move apart to form deep cracks in the crust. B. Plat
    10·2 answers
  • This is a tiny fluid-filled cavity in the cytoplasm. It can be used for storage of biochemicals.
    15·2 answers
  • Can someone pls give me the answer to this?
    14·1 answer
  • Which of the following compounds cannot freely diffuse through the plasma membrane
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!