1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
11

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ

ences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?
Biology
1 answer:
konstantin123 [22]3 years ago
3 0
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



You might be interested in
Why are there no samples of rocks from the early Precambrian era?
xenn [34]

Answer:

The correct answer is -  D. All rocks were molten in that time period.

Explanation:

The early Precambrian era began 4.6 billion years ago. The formation of eath start from this era with dust and gas. The atmosphere at that time was too hot. It was like hades. The rocks were molten and appear to like an ocean of rocks.

Due to the molten rocks, there are no samples of rock from this area as it was too hot to be formed. There were boiling sulfur and gases were everywhere.

4 0
3 years ago
Some birds are known as honey guides because they may be followed by humans to wild beehives. When the humans take honey from th
zloy xaker [14]

Answer:mutualism

Explanation:

In a mutualistic relation,both organisms involved benefit from the activities of each other. The benefits may be nourishment,shelter, protection etc.

In the above example,the birds are known to guide humans by responding to specific calls made by the human. They guide humans to beehives and then in return gets to feed on left over honey. Both the bird and human benefits by getting nourishment.

Mutualism is unlike parasitism where one of the organism involved benefits and the other organisms Is most likely harmed. It is also not commensalism, where one organism benefits and the other neither benefits nor is harmed

3 0
3 years ago
Which listed transfusion reaction is most often associated with transfused patient's lacking iga?
IgorC [24]
The most common transfusion reaction, especially in patients lacking either IgA especially serum IgA, is the development of potentially severe hypersensitivity reactions or anaphylaxis. The most probable culprit is the presence of IgA in the transfused blood, because since the individual lacks IgA, then the IgA in the transfused blood is considered a foreign body triggering an allergic response.
3 0
3 years ago
A celestial object takes six to seven years to revolve once around the Sun. It’s made mostly of ice, some of which vaporizes whe
Nadusha1986 [10]
A comet. It’s a smaller celestial body that’s composed of mainly ice and dust.
3 0
3 years ago
Read 2 more answers
The ability to fuse one's identity with that of another without fear of losing it characterizes what erikson called
liq [111]

Solution:

The ability to fuse one's identity with that of another without fear of losing it characterizes what erikson called the psychosexual.

Thus this the required answer.

8 0
3 years ago
Other questions:
  • The resistance of a population to an attack by a disease to which a large proportion of the members of the group are immune is r
    6·1 answer
  • This type of diabetes eventually result in all of the insulin producing cells in the pancreas being destroyed ?
    5·1 answer
  • How do organic compounds differ from inorganic compounds?
    9·1 answer
  • Explain how available energy changes at each trophic level. What happens to the energy that is lost?
    10·1 answer
  • Number 4 for the explain your reasoning part please help 30 points!!
    6·1 answer
  • All of the following are at fault for releasing too much greenhouse gas except
    11·2 answers
  • A community in the final stage of succession - a community remains relatively unchanged until destroyed by an event such as fire
    14·1 answer
  • A. Make a list of as many traits as you can think of that could be used to classify a new species.
    15·1 answer
  • How is oceanography a multi-science field?
    15·1 answer
  • Breathing involves the movement of diaphragm and Rib cage<br><br><br><br>true or false​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!