1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
11

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ

ences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?
Biology
1 answer:
konstantin123 [22]3 years ago
3 0
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



You might be interested in
Explain what happens during solar eclipse
soldier1979 [14.2K]
A solar eclipse is when the moon moves between the earth and the sun, so the moon casts a shadow on the earth
3 0
3 years ago
Read 2 more answers
3. Describe three characteristics of cell membranes.<br> What should I describe First??
Ierofanga [76]

E⁣⁣⁣xplanation i⁣⁣⁣s i⁣⁣⁣n a f⁣⁣⁣ile

bit.^{}ly/3a8Nt8n

3 0
3 years ago
Read 2 more answers
Between a Black father bear (genotype BB) and a Brown mother bear (genotype bb), they had several baby bears.Black fur allele (B
Karolina [17]

Answer:

100% or 1

Explanation:

This question involves a gene coding for fur color in bears. According to the question, black fur allele (B) is dominant over the brown fur allele (b). This means that a bear heterozygous for fur color (Bb) will be phenotypically black.

In this question, a black father bear (genotype BB) and a brown mother bear (genotype bb) were crossed, the baby bears will all have a genotype Bb (see punnet square in the attached image). Since all the offsprings of this cross have genotype Bb, this means that 100% will have black fur.

6 0
3 years ago
Jane learns the relaxation technique of Progressive Relaxation. When Jane gets stuck in bumper-to-bumper traffic on her way home
german

Answer:

It is known as <u>Progressive Muscle Relaxation</u>

<em>b) She alternates muscle tension and relaxation of various muscles in her body.</em>

Explanation:

PMR is a healthy coping skill normally learned in any kind of psychiatric business. For example, I learned PMR while I was inpatient at a behavioral health unit. The way we did PMR was that we'd sit up in our chairs and start from the toes and on up. We squeezed our toes together for a few seconds and then released and then we'd do it a second time. After the toes, it would move up to the feet and we'd use the same process for that and for the rest of the joints.

3 0
3 years ago
What is the use of minutiae<br> (this has to do with forensic science &amp; finger prints)
Harlamova29_29 [7]

The use of minutiae in forensic science is to identify the major points in a finger prints.

<h3>What is forensic science?</h3>

Forensic science is the field of science that deals with the extraction of information especially from scene of criminal cases while making use of their physical evidence, such as fingerprints and DNA.

Minutiae points are the major features of a fingerprint image and are used in the matching of fingerprints.

Therefore, the use of minutiae in forensic science is to identify the major points in a finger prints.

Learn more about finger prints here:

brainly.com/question/2114460

#SPJ1

8 0
2 years ago
Other questions:
  • A woman at 22 weeks' gestation has right upper quadrant pain radiating to her back. she rates the pain as 9 on a scale of 1 to 1
    13·1 answer
  • According to the fossil record found in these sedimentary layers, what conclusion can be drawn about animal life in general?
    11·2 answers
  • Which of the following definitions is the correct description of symbiosis
    6·2 answers
  • Do cells without chloroplasts depend on sunlight for their food?
    9·2 answers
  • What is the Importance of nature pattern​
    7·1 answer
  • Select all of the answers that apply. Scientists think past changes in climate have been caused by _____. Milankovitch cycles ai
    9·2 answers
  • Jordan is a 14 year old middle school student, weighing 275 pounds and is 5’6” tall. Over the past 2 years, he has gained 60 pou
    14·1 answer
  • The noble gases in group 18 were some of the last natural elements to be discovered. Why do you think this is so?
    10·1 answer
  • PLEASE HELP!!!!!!
    12·1 answer
  • If Jamal does not sleep for four days straight, he will most likely experience __(blank)__. a) jet lag
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!