1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
2 years ago
11

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ

ences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?
Biology
1 answer:
konstantin123 [22]2 years ago
3 0
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



You might be interested in
PLEASE HELP!
Andreyy89

Answer:

9:enforcement terrorism, 10:true,11:true

5 0
3 years ago
A single strand of DNA helix has the code CGCTAA. Which would be the complementary code on the other strand of the helix?
Yakvenalex [24]

The correct answer is option 4, that is, GCGATT.  

Complementary strand refers to either of the two chains, which forms a double helix of DNA, with corresponding positions on the two chains comprising of a pair of complementary bases. It is a section of one nucleic acid, which is bonded to another by an alignment of base pairs.  

In nature, complementarity refers to the base principle of DNA transcription and replication as it is a characteristic shared between the two RNA or DNA sequences, such that when they are arranged antiparallel to each other, the nucleotide bases at each position in the sequences will be complementary.  


7 0
3 years ago
Read 2 more answers
You crossed a plan with red flowers with a plant with white flowers both plants are pure breeding all the aspirins have pink flo
Flura [38]
Heterogenous dominant i'm fairly sure
6 0
2 years ago
Are organisms that rely on external fertilization are more likely to produce large numbers of sperm and eggs than those that use
Tamiku [17]
Yes, those that use external fertilization are more likely to produce large numbers of sperm and eggs.
4 0
2 years ago
Diffusion can be defined as ---.
insens350 [35]

Answer:

Movement of particles from a region of high concentration to a region of low concentration

Explanation:

  • Diffusion can be defined as the movement of particles from a region of high concentration to a region of low concentration.
  • Diffusion is a special type of diffusion that involves movement of solute molecules from a region of a high concentration to a region of high concentration until equilibrium is achieved.
  • Diffusion is a passive transport of particles, which means it does not involve use of energy in the form of ATP like the case of active transport.

8 0
3 years ago
Other questions:
  • What ways does a frog differ from a tadpole
    10·2 answers
  • Approximately how long has the victim been dead if his body temperature was 78.6°F?
    5·1 answer
  • Describe 3 ways in which the organs of the circulatory system and respiratory system are protected
    7·1 answer
  • Do birds keep theit eggs inside or outside
    14·1 answer
  • The total magnification of a specimen viewed under a compound light microscope is determined by the power of the objective lens
    6·2 answers
  • Answer Choices:
    14·1 answer
  • photosynthesis and cellular cellular respiration are two of the main processes involved in carbon in the carbon cycle photosynth
    8·1 answer
  • The stage in the cell cycle during which the cell performs its normal function
    15·1 answer
  • PLSSS HELP IF YOU TURLY KNOW THISS
    15·1 answer
  • PLSSS HELP IF YOU TURLY KNOW THISS
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!