1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
11

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ

ences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?
Biology
1 answer:
konstantin123 [22]3 years ago
3 0
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



You might be interested in
When electrons are removed from a food molecule, it is
sweet [91]

Answer:

Oxidized

Explanation:

5 0
3 years ago
What directs similar cells to change into a specific organ?
Marat540 [252]
Deoxyribonucleic acid 
4 0
3 years ago
Read 2 more answers
What does lipase do​
kirza4 [7]

Explanation:

The pancreas produces lipase during digestion. This enzyme helps the intestines to break down fats.

6 0
3 years ago
A mating between a male donkey (2n = 62) and a female horse (2n = 64) produces sterile mules. why are mules sterile?
kirza4 [7]

The horse and donkey, though closely related by sharing a common ancestor, are different species. They have different number of chromosomes hence pairing of homologous chromosomes during fusion of gametes becomes complicated. The mule will have an extra chromosome from the horse hence will have abnormalities such as sterility. A Mule is unable to reproduce due to this same phenomenon. Homologous chromosomes are not well paired for meiosis I.






6 0
3 years ago
An allele is a form of a gene. In the cross HhSs x hhss, how many alleles does the kitten inherit from the father?
Elina [12.6K]
WhAt is tjis I’m so confused
3 0
3 years ago
Other questions:
  • Which of the following cells would not divide using mitosis?
    11·2 answers
  • What happens during crossing over
    7·2 answers
  • Scientists have documented that spring seasons starting earlier due to climate change have resulted in some caterpillar species
    5·1 answer
  • During the warm days of summer in the Arctic, mosquitoes breed exponentially. When winter comes, the population falls off severe
    10·1 answer
  • Jessica reads that microwaves, infrared waves, X-rays, and gamma rays can damage human tissue while radio waves cannot. What can
    15·1 answer
  • How will you know if the friction is static? Give an example
    7·1 answer
  • Identify the polysaccharide formed from the enzyme insulin as a means to remove glucose from the blood.
    6·1 answer
  • The genetic code is defined degenerate or even redundant because:
    12·1 answer
  • 4. Some groups of organisms move from colder climates to warmer climates at
    15·1 answer
  • When a person bends a glow stick a small chamber inside it breaks releasing a substance that reacts with other substances inside
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!