1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
11

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ

ences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?
Biology
1 answer:
konstantin123 [22]3 years ago
3 0
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



You might be interested in
The heritability of intelligence is highest among select one:
uranmaximum [27]
The correct answer is a: genetically similar individuals who have been raised in similar environments.
<span>For example, monozygotic twins, who share 100% of their DNA that grew up in the same home have the highest correlation of their IQs (correlation is 0.86). </span>
3 0
3 years ago
Sunflowers have specialized cells that enable the sunflower to track the
Molodets [167]
B. i searched it up
7 0
3 years ago
What is the basic unit of a nucleic acid and what is it made of?
riadik2000 [5.3K]
The basic repeating unit of nucleic acids are known as nucleotides. A nucleotide consists of three distinct chemical groups, a 5-carbon sugar (ribose or deoxyribose), a nitrogen-rich base - (cytosine (C), guanine (G), adenine (A), thymine (T) in DNA or uracil (U) instead of T (in RNA), and phosphate.
4 0
3 years ago
Read 2 more answers
What type of rock is formed from compaction or cementation?
Marina CMI [18]
Sedimentary rocks are formed by cementation and compaction. This happens when sediment particles are compressed and fused together over very long periods of time. 
4 0
3 years ago
Read 2 more answers
3. How would you differentiate between natural selection and artificial selection<br>​
slava [35]

Answer:

Natural selection is the process whereby organisms better adapted to their environment tend to survive and produce more offspring. The theory of its action was first fully expounded by Charles Darwin and is now believed to be the main process that brings about evolution while Artificial selection is Selective breeding is the process by which humans use animal breeding and plant breeding to selectively develop particular phenotypic traits by choosing which typically animal or plant males and females will sexually reproduce and have offspring together.

3 0
3 years ago
Other questions:
  • Which best describes how the fossil record supports the theory of evolution? The fossil record shows exactly how all species hav
    14·2 answers
  • Is there a difference between plants and animal requirements for energy?
    7·1 answer
  • Please Help
    7·2 answers
  • plate tectonics can help explain which of the following a. ocean currents b. weather systems c.land errosion d. trenches
    12·2 answers
  • Suppose a population is carrying a condition controlled by two alleles: R (dominant) and r (recessive). Only homozygous individu
    9·1 answer
  • How much dna is in each nucleus of each cell
    11·2 answers
  • 14. The elements in group_
    11·1 answer
  • some vitamins are mostly found in animal-based foods, while some vitamins are abundant in plant-based foods. the best source of
    13·2 answers
  • Answer the question below
    14·2 answers
  • Explain why Aracaju is warmer than Lima.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!