1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
11

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ

ences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?
Biology
1 answer:
konstantin123 [22]3 years ago
3 0
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



You might be interested in
Im giving 50 points please give correct answers. Research the industrial revolutions in the 1800s. the evaluate the following cl
Aliun [14]

Answer:

"The most significant effect of population growth in Europe from 1700 to 1800 was urbanization and the creation of large cities which was marked by poverty, crime, and poor sanitation.” Historians have identified several causes for the Industrial Revolution, including: the emergence of capitalism, European imperialism, efforts to mine coal, and the effects of the Agricultural Revolution. Capitalism was a central component necessary for the rise of industrialization.

6 0
2 years ago
Describe the relationship between Pedersin cleaner shrimp and the sea slug
almond37 [142]
Ok,,,,,,,,,,,,,,,,,,,,,,,
4 0
3 years ago
Habitat destruction, and thus habitat fragmentation, is the major cause of declining biodiversity; the second major cause is ___
alekssr [168]

Habitat destruction, and thus habitat fragmentation, is the major cause of declining biodiversity; the second major cause is <u>Invasive Species</u>.

The process by which a natural ecosystem can no longer support its native species is known as habitat destruction. Reduced biodiversity and species abundance result from the displacement or death of the creatures that once occupied the area. The loss of biodiversity is mostly caused by habitat degradation.

An imported organism that overpopulates and damages its new habitat is referred to as an invasive species. Even though the majority of imported species are neutral or helpful to other species, invasive species have a negative impact on habitats and bioregions, harming their ecology, the environment, and/or their economy.

The most frequent methods for invasive plants, animals, microorganisms, and other species to spread to new ecosystems are thought to be human activities like those involved in international trade and the pet trade.

To learn more about Invasive Species refer from

brainly.com/question/21452505

#SPJ4

6 0
1 year ago
Now that you have reviewed normal blood flow, why does a patient with left-sided heart failure have a low systolic blood pressur
Mnenie [13.5K]
<span>The Left-sided Problem of the heart involves the lack of enough supply of oxygen induced blood and the blood which is unable to reach the heart goes to lungs causing breath issues. Another issue with this problem is that left side of the heart pumps blood into the body, so when it fails, less blood will be pumped into the arteries.</span>
6 0
3 years ago
A marine biologist dredges up a small animal from the bottom of the ocean. it is uniformly segmented, with short, stiff appendag
zhenek [66]

First, a complete digestive system means that the digestive tract has a beginning or the oral end and the opposite end or the aboral end. This is found in more complex animals starting from roundworms (flatworms have an incomplete digestive tract). A closed circulatory system is found in animals more recent than mollusks. The presence of the coelom makes it more evolved than the flatworms. 


Specifically, a small animal with a segmented body, short stiff appendages, and soft skin with the above characteristics point out to the phylum Annelida or annelids.

8 0
3 years ago
Other questions:
  • Where dose condensation occur?
    10·1 answer
  • Betty, 66 years old, is in great physical shape. she works out at the gym every day, and recently her doctor told her she is in
    15·1 answer
  • Por qué la halló a cruso la calle
    7·1 answer
  • A- 0.455 g B- 5.50 g C. 4.56 g D. 0.55 g
    11·1 answer
  • True or False: Vampire bats exist.<br> True<br> False
    10·2 answers
  • Where do new genes come from
    10·2 answers
  • What is a biofilm and what role does biofilm play in disease?
    10·1 answer
  • -<br> An organism is a life form consisting of one or more
    6·1 answer
  • Think about a petal plucked from its flower. Is the petal alive according to the characteristics of life ? Why or why not ?
    7·2 answers
  • Why do organisms maintain fairly steady conditions within their cells and<br> bodies?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!