1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
11

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ

ences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?
Biology
1 answer:
konstantin123 [22]3 years ago
3 0
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



You might be interested in
How does energy flow between the sun plants and other organisms?
SSSSS [86.1K]
The continual input of energy, mostly from sunlight, sustains the process of life. Sunlight allows plants, algae and cyanobacteria to use photosynthesis to convert carbon dioxide and water into organic compounds like carbohydrates. This process is the fundamental source of organic material in the biosphere. There are a few exceptions to this, such as ecosystems living around hydrothermal vents on the ocean floor, which derive their energy from the chemical compounds such as methane and hydrogen sulfide. In either case, the overall productivity of an ecosystem is controlled by the total energy available.
8 0
2 years ago
Which is an example of population density?
Arisa [49]

Answer:

The example for population density is "two jaguars per thousand hectares"

Explanation:

To known the population size per unit area we use population density. Or sometimes use it for volume. It is expressed in quantity or in the type.  Mostly used for the living organisms, specifically humans. It's unit is expressed in square kilometers or may say in square mile. It is used for country, city, town and another territory. The negative relationship is found to affect the population density. It depends on the reproduction and survival.

5 0
3 years ago
A model of a DNA molecule is shown below. The arrow indicates...
matrenka [14]

Answer:

The hydrogen bond between complementary nucleotides (C)

Explanation:

Hope this helped

4 0
3 years ago
Read 2 more answers
Question:
natita [175]
Y=-(x^2-20x+64)
----find two numbers that multiply to 64 and add to -20. They are -16 and -4--
y=-(x-16)(x-4)
ROOTS : 16, 4
3 0
3 years ago
Which of the following statements is/are true of long noncoding RNAs? Choose one or more: a. They can trigger the activity of hi
Alinara [238K]

Answer: Options A, B, C and D are correct.

Explanation: They can trigger the activity of histone acetyltransferases.

These RNAs functions by binding to histone-modifying complexes, to DNA binding proteins (including transcription factors), and even to RNA polymerase II.

They can silence genes by promoting the formation of euchromatin by arranging hetero- or euchromatic regions into close proximity may stabilize these domains or it may control the spreading of post-translational modifications (PTMs) to nearest chromatin.

They are actively involved in X chromosome inactivation.

They can regulate the translation and stability of mRNAs.

In Eukaryotic cells RNA transcription is a closely regulated process. Transcription of a lncRNA may regulate the transcription of nearby mRNA genes, either positively (maintaining active chromatin structure) or negatively (for example, colliding polymerases). In these cases, the RNA product may have no importance at all, or it could have an additional function.

8 0
3 years ago
Other questions:
  • What may happen if a pollutant manufacturing waste and pesticides enter the ground water
    6·1 answer
  • I need help please !
    9·1 answer
  • When graphin the independent variable shoe be placed on the y axis true or false
    14·1 answer
  • Which two terms are most closely related to learned behavior?
    10·2 answers
  • Weathering deposition and cementation are all involved in the formation of a rock. what type of rock is it?
    10·1 answer
  • Shortly after adopting his cat, Sassy, Thomas realizes that his poor cat isn’t eating very much. After ruling out any illnesses,
    9·1 answer
  • Consider the factors that affect muscular strength. Read each scenario and then identify each label into the appropriate categor
    6·1 answer
  • Why does a violet flower look violet?
    14·2 answers
  • Use the information gathered in the A Three Point Test Cross animation to answer the question. Genes H and K are linked and are
    8·1 answer
  • A specialized cell performs
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!