1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luden [163]
3 years ago
15

Water is a good solvent and has a high heat capacity. Why are these two characteristics important for life?

Biology
1 answer:
Lorico [155]3 years ago
4 0

Living Organisms Respond to their Environment. All living organisms are able to react to something important or interesting in their external environment. For example, living organisms constantly respond to their environment. They respond to changes in light, heat, sound, and chemical and mechanical contact.

You might be interested in
Convert 10,095m/s to miles/s
klemol [59]
It gives me 22581.872
5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What type of tissue connects all parts of a plant allowing for nutrients and water to flow throughthe plant?
Norma-Jean [14]

The tissue you are referring to here is the xylem, a <u>vascular tissue</u>, whose basic function is to transport water and nutrients from the roots to the rest of the plant.

3 0
3 years ago
8(b)(i). Diagram 8.2 shows part of the Periodic Table. State the type of<br>element for P. *<br>​
chubhunter [2.5K]

Answer:

<u><em>Phosphorus</em></u>

Phosphorus is a chemical element with the symbol P and atomic number 15. Elemental phosphorus exists in two major forms, white phosphorus and red phosphorus, but because it is highly reactive, phosphorus is never found as a free element on Earth.

Explanation:

Brainliest?

6 0
3 years ago
How have crops been modified?
frez [133]

Answer:

Plants have been made more susceptible to pests for modification.

8 0
4 years ago
Other questions:
  • Driving involves taking some risks __________.
    9·2 answers
  • According to karl menninger, individuals who harm themselves by means of drugs, alcohol, smoking, or reckless driving are effect
    12·1 answer
  • Which of the following describes mass
    12·1 answer
  • What was Rudolf Virchow trying to prove through his work?
    12·2 answers
  • What happens to the nitrogen stored in dead plants and animals?
    11·1 answer
  • The temperate grasslands, also called prairie, feature hot summers and cold winters. Rainfall is uncertain and drought is common
    6·1 answer
  • A living or once-living organism in an ecosystem is a “ex factor” “biotic factor” “abiotic factor” or “the facts of life”
    6·1 answer
  • Examples of asexual
    10·2 answers
  • Why does liquid expand when frozen? please keep it simple.
    11·1 answer
  • How can tools be useful to scientists who study minerals?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!