1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serggg [28]
4 years ago
10

The nurse explains a certain procedure to a client. the client seems shy, so the nurse encourages the client to ask questions. w

hat is the correct term for this example of critical thinking by the nurse
Biology
2 answers:
timama [110]4 years ago
8 0
Is call Confidence of patient care.
vova2212 [387]4 years ago
8 0

Answer:

The correct answer is "Confidence".

Explanation:

One important factor related to patient care is to build the patient's confidence. The patient must feel free to ask questions in order to trust that she or he recevided a proper diagnosis and that the treatment would be adequate. This helps the patient to relax and, most of the time have a beneficial effect in the treatment. In this example the nurse encourages the patient to ask questions. This is an effective approach to build the patient's confidence by establishing an effective communication.

You might be interested in
Nasha left a hot bowl of soup in a cool room. Her friend tells her that her soup will get cold if she forgets to eat it. How col
Harman [31]

Answer: Only a little colder.

Explanation: It started out much hotter, so it will stop cooling down before it reaches the same temperature as the room.

4 0
3 years ago
Read 2 more answers
Question 10
densk [106]
DNA is made up of the individual units called Nucleotides.
4 0
3 years ago
Describe the roles of light, carbon dioxide, and water in photosynthesis
MArishka [77]
The process of photosynthesis occurs when green plants use the energy of light to convert carbon dioxide (CO2) and water (H2O) into carbohydrates. Light energy is absorbed by chlorophyll, a photosynthetic pigment of the plant, while air containing carbon dioxide and oxygen enters the plant through the leaf stomata.
5 0
3 years ago
Which would most likely happen if a cell undergoes mitosis, but not cytokinesis?
steposvetlana [31]

Answer:

A

Explanation:

Logically, the cell would have two nuclei because karyokinesis (the division of the nucleus) occurs before cytokinesis (division of the cytoplasm).

6 0
3 years ago
Which of the steps in this sequence of events is an example of mitosis at work?
taurus [48]
<span>The bruise slowly disappears as the arm heals.

</span>
<span>The two identical daughter cells resulting from mitosis and cytokinesis are identical in the following ways:1. Mitosis occurs when the nucleus of the cell divides into two identical nuclei, each with the same type and number of chromosomes. The cell's DNA is duplicated during this phase. Sometimes the cell's DNA isn't copied properly resulting in cancer-type cells. 2. Cytokinesis is when the cytoplasm divides into two identical daughter cells. Each cell is genetically identical and both are a similar size.
</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Cellular respiration involves the complete breakdown of what to carbon dioxide and water
    11·1 answer
  • A Kitten was born with black fur and green eyes. The fur and eye color are shown in the chart (picture above).
    13·2 answers
  • In which plants' life cycle does double fertilization occur?
    12·2 answers
  • Science
    10·1 answer
  • Composed of water, acids, and mucous secretions. what types of chemical bonds are likely to anchor and stabilize these long, sle
    6·2 answers
  • Which one of the following is NOT a cause of anemia?
    5·1 answer
  • Reading scientific reports is an example of what?
    14·1 answer
  • Why does the land around a once active coal mine remain barren?
    11·1 answer
  • Lab: Flower Dissection
    5·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!