1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
defon
4 years ago
8

Who are the three main groups involved in natural resources and what are their roles?

Biology
1 answer:
Flauer [41]4 years ago
8 0

Biotic natural resources also include fossil fuels such as coal and petroleum which are formed from organic matter that has decayed. Abiotic: these resources come from non-living and non-organic material. Examples of these resources include land, fresh water, air, and heavy metals (gold, iron, copper, silver, etc.).

You might be interested in
Her immune system is exhibiting the _ line of defense. This defense is part of _ immunity.
lisov135 [29]

last line of defense is the first part.

and the defense is part of her system immunity. this makes sense since the immune system is used to guard against viruses and diseases

4 0
4 years ago
Hey Everyone!
GrogVix [38]

<h3>auhmm, I suggest you...u can search it on yt.....I'm expecting a lot it can hepl's ur problem....❤️❤️</h3>

Explanation:

<h2>#GODBLESS❤️</h2>
8 0
3 years ago
Read 2 more answers
What type of muscle is the inside of the uterus lined with?
vitfil [10]
The endometrium is the inner lining. The myometrium is the thick middle muscle. The serosa is the outer smooth layer.
7 0
3 years ago
What occurs during a decomposition reaction? The components of several molecules recombine to form new molecules. A compound par
Volgvan
<span>During a decomposition reaction, a compund partitions into it's components. This is a type of a chemical reaction where a larger/more complex compund is broken down into simpler elements or compounds which were initially combined in a chemical reaction.This type of reaction often requires an energy source such as heat or light to break down the compound.</span>
4 0
3 years ago
WILL MARK YOU BRAINLIEST!
Andreyy89
Which one all of the or what
7 0
3 years ago
Read 2 more answers
Other questions:
  • Portions of the genomes of certain prokaryotic species are very similar to portions of the genomes of distantly related prokaryo
    14·1 answer
  • The nurse is caring for a spanish-speaking patient who is visually impaired. how can the nurse ensure an effective teaching–lear
    8·1 answer
  • Smoking may lead to weight gain because it increases the body's capacity for physical activity true or false
    6·1 answer
  • 6. the part of the circulatory system that brings carbon-dioxide filled blood to the lungs cell
    13·1 answer
  • Red-green color blindness is due to an X-linked recessive allele in humans. A widowâs peak (a hairline that comes to a peak in t
    10·1 answer
  • Summary how the fast carbon cycle works?
    15·1 answer
  • Does anyone know the missing ones?
    15·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • To use less of a resource
    14·1 answer
  • How have scientists started to study relationships between different groups of organisms?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!