1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimaraw [331]
3 years ago
10

During photosynthesis, the light energy from the sun is captured and stored in the bonds of _____.

Biology
1 answer:
Karo-lina-s [1.5K]3 years ago
8 0
ATP between the 2nd and 3rd phosphate
You might be interested in
Can anyone tell me ideas of science pprojects? Thanks!
Gnoma [55]
Are you looking for projects like experiments? 
3 0
3 years ago
Read 2 more answers
Which of the following molecules supplies the main source of short term energy used in cellular respiration?
user100 [1]

Answer:

G- carbohydrates

3 0
3 years ago
Explain how Darwin would have explained the many different variations of guppies.
ohaa [14]

Answer :<em> That trough time, a specie of animal, plant, bacteria can change. </em>

<em> </em>

<em>When a life form reproduces, one of its"babies" may be different from its parents because of genetic mutation. </em>

<em />

5 0
3 years ago
What do you call a trait caused by a gene on chromosome 1?
andrew-mc [135]
I'm guessing the answer is a
5 0
3 years ago
Certain exposures to radiation can cause cancer. What is the main difference between the use of radiation treatments to treat ca
jonny [76]

the radiations that are used to treat cancers are of the gamma type. primarily emitted from cobalt-60 (a radioactive isotope).  and it is more controlled than other radiation exposures. i.e. solar radiation which is not controlled.

hope that this helps.

4 0
3 years ago
Other questions:
  • From the origins of the human species some 3 million years ago until about the year 1800, most people in the world lived in whic
    9·1 answer
  • What is the main difference between cytokinesis in plants and animals?
    14·1 answer
  • ________________ are a type of zygomycetes.
    12·2 answers
  • Helppppppppppppppppppppppppp!!!!?!?!?!?!!!
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In which type of exercise would fat reserves be used to create ATP
    13·1 answer
  • Which statement best explains how two identical copies of a very large molecule can be made during DNA replication?
    15·2 answers
  • True or False. The net force on an object is the combination of all the forces acting on the object.
    8·1 answer
  • 4. During _____ both the contents of the nucleus and the cytoplasm are divided
    12·1 answer
  • What is the difference between a trapezoid and a rhombus? A) A trapezoid is a parallelogram and a rhombus is not. B) A rhombus a
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!