Here are some 5 facts I find interesting
-Some people use the term lithosphere to describe the geosphere. Depending on the definition of geosphere (which is debated by scientists), lithosphere can mean the same thing.
-The geosphere includes everything that looks like solid ground, including the ocean floors, sand in the deserts, rocks, mountains and every bit of land or formation on the continents.
-Aristotle, the Greek philosopher who lived from 384 - 322 BC, considered the geosphere to include the motion of earth, water, fire, and air
-There are eight major tectonic plates making up the earth's geosphere. They are constantly moving, but usually only a few centimeters each year,
-Scientific study related to the earth's geosphere can be broken down into specific disciplines including those covered in geology, geography, geochemistry, geomorphology, geophysics, glaciology, mineralogy, petrology, and volcanology.
1 .federalism is defined as a system of government where there is one strong,central controlling authority,or principles of political party called the federalist.
2.the purpose of the bill of right is to protect the basic right of US citizens,guaranteeing the freedom of speech,press,assembly and exercise of religion e.t.c
3. The founders were determined to bind down the administrators of the federal government with constitutional chains so that abuse of power in any of its branches would be prevented
Answer:
no, and i know you just pooped your pants , nasty go clean after your self
Explanation:
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
