4 years ago

Which provides the energy that allows all anabolic reactions to proceed?

Biology

2 answers:

Naddika [18.5K]4 years ago

8 0

It's ATP that provides the energy that allows all anabolic reactions to proceed.

olasank [31]4 years ago

3 0

Answer: ATP

Explanation:

The only source of energy in human body is adenosine triphosphate. The energy is stored in the bonds of ATP.

When the cells require energy then the ATP is converted into adenosine diphosphate and inorganic phosphate (ADP+Pi).

This breaking of bond releases energy which is used by the cells of the body.

You might be interested in

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ

Pani-rosa [81]

The probe would need to bind to the site
TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is complementary and antiparallel to it.

4 0

4 years ago

What happens if the immune system fails to produce proteins called antibodies

Oksi-84 [34.3K]

Answer:

the defenses are down

Explanation:

antibodies are actually quite necessary, they come from helper b cells to help fight infections, and even though helper t cells can fight, your body still needs antibodies hope i helped!

5 0

3 years ago

Help!!! The question is in the picture.

Natali [406]

Answer:

18 is the nuclesus, 20 is the smooth endoplasmic reticulum and 21 is the golgi apparatus and 19 is the microtubes and 17 is the vacules.

Explanation:

5 0

3 years ago

List the safety precautions that should be observed when inserting, or removing glass tubing from a rubber stopper or rubber hos

wel

No glass breakage , safety trash bin gloves