1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
3 years ago
8

Recently, Jonesville County inhabitants have been embroiled in a controversy regarding the use of pesticides on crops grown in t

he county. The Jonesville Express interviewed county residents for opinions on pesticide use. Below is a sampling of their responses.Charles Ehler, farmer: I’m not going to use those pesticides because I don’t want to end up with leukemia. Maurice Gordon, farmer: The people who oppose the use of pesticides should have to decide which third of the world would starve.Wendell Mullison, chemical salesman: The health risks are minimal because these chemicals have been intensively tested by the chemical companies. Robert Rodriguez, Environmental Protection Agency employee: I worry about pesticides that find their way into groundwater. My agency has trouble keeping up with the new developments in farm chemistry. We don’t even test the water for most of the pesticides that are in use today. Bessie Smith, 80-year-old resident: I’m against pesticides. When those planes spray on the farm next to me, most of those chemicals end up in my yard. Alice Evans, farmer: I couldn’t earn a living without pesticides. My farm would not make a profit. Judy Johnson, college professor: We’re in a vicious cycle. We develop pesticides, apply them, andthe pests evolve resistance. Then we have to do it all over again. Ben Jackson, librarian: Pesticides are much safer than they used to be. The newer pesticides only affect specific pests and break down more quickly in the environment.Required: 1. Select four of the people interviewed. Provide a concise argument, based on scien-tific principles, that supports or refutes each individual’s viewpoint.2. Identify one specific pest and explain its adverse effects on either agriculture or human health.3. Describe a viable method, other than the use of pesticides, of controlling this pest.
Biology
1 answer:
LenKa [72]3 years ago
6 0

Answer:

Charles Ehler: incorrect.

Wendell Mullison: correct.

Robert Rodriguez: correct.

Judy Johnson:correct.

Explanation:

-Charles Ehler´s statement is incorrect because in order for a chemical company launch a new product it must pass several tests, that´s why products lasts years in proves, there are several tests such as the environment test that proves that the product doesn´t affect other species, or the human safety that makes sure the product doesn´t affect human health.Wendell Mulison´s statement proves to be correct with this as well.

-Robert Rodriguez´s statement  is correct because even though there are several tests that take care human healt there are just a few based on the damage pesticides produce to the land where are used.

-Judy Johnson´s statement is correct because science has proved that the resistant of parasites as being increasing with the products tat are used to combat them. Bacterias are an example of it, many drugs used against bacterias are now useless for some people because of the resistantthey have developed.

-One specie that can be taken as a pesticide can be the ground snail, that affects some plants and also may contain a parasite aclled "Hepatic fasciola" that affects sheeps and goats of farmers.

-One viable method to control pesticides is the sue of other species to control them, this specie has to be adequate to the land, for example, if a farmer wants to get rid of the ground snails because of the parasite and  the damage they do to their platings, they can introduce ducks to the farm that eat them without damaging the land with any kind of chemical product.

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which one is NOT one of the properties of water?
marysya [2.9K]

Answer:

a. the frozen form is more dense than the liquid form

Explanation:

The remaining properties are exhibited by water and are described as follows.

b. the frozen form is less dense than the liquid form

1. Water freezes to form ice.

2. When ice is put in water, ice starts floating in water and is visible.

3. If the density of ice was greater than water, ice would have got sunk and go downwards in the water body.

4. Hence, ice which is frozen form of water, has less density than water.

c. water is a solvent

1. The solvency is defined as the ability of a liquid to dissolve a substance.

2. Water is called the universal solvent. This means water can dissolve almost all types of substances.

3. Water is a polar solvent. The polar water molecules have the ability to break down both ionic and covalent bonds.

d. water has a high heat capacity

1. This is defined as the amount of heat needed by 1 gram of a substance so that its temperature is changed by 1 degree centigrade. The heat can either be gained or lost for the temperature to change.

2. The heat required by 1 gram of water to either increase or decrease the temperature of water is called the heat capacity of water.

e. water has a high heat of evaporation

1. This is defined as the amount of heat needed by 1 gram of a substance so that it changes its state from liquid to gas.

2. The heat required to convert 1 gram of water into vapours is called the heat of evaporation of water.

3. 1 g of water when heated at 25 centigrade needs 580 calories of heat to convert into gas.

All the above properties of water show the importance of water for life.

7 0
3 years ago
A mild sunburn, medically speaking, is often considered in terms very similar to mild
Len [333]

Answer:

True

Explanation:

Sunburn (First-Degree Burns): A sunburn is skin damage from the sun's ultraviolet (UV) rays. Most sunburns cause mild pain and redness but affect only the outer layer of skin ( first-degree burn). The red skin might hurt when you touch it. These sunburns are mild and can usually be treated at home.

4 0
3 years ago
Read 2 more answers
What type of macromolecule helps package dna in eukaryotic chromosomes?
kakasveta [241]
"Protein" helps in packaging of DNA<span> in eukaryotic chromosomes

Hope this helps!</span>
7 0
3 years ago
all of the following are reasons why friendships are more highly valued by older people in late adulthood than family relationsh
Leviafan [203]

There are no choices but the reason why we tend to value friends as we grow older is because these are bonds that we create on our own.  These are people who have been there for us throughout our lives. They are our link with the outside world since they are not our family members.  The longer we are friends with others, the deeper that bond becomes.

3 0
3 years ago
Other questions:
  • Which correctly describes the term demographic transition?
    7·2 answers
  • Q: Those are called homolgous structures because the skeletons are very similar and imply a common ancestor!!!! HOW DO I ANSWER
    6·1 answer
  • Mike and Veronica are expecting their first child and they are nervous about all of the possible health issues a baby can face.
    9·2 answers
  • Describe the process of altering the genetic variation of a cell using a genetically modified virus for human gene therapy. In t
    6·1 answer
  • What is the measles virus made of?
    6·2 answers
  • Crop pollination, water purification, and moderation of weather extremes are just a few examples of __________. answer biologica
    7·1 answer
  • 57:23
    7·1 answer
  • Which is an example of interdependent body systems working together to maintain homeostasis?
    9·1 answer
  • 2. Is wastage of food also wastage of energy? Why do you think so?​
    11·2 answers
  • The outer boundary of living protoplasm in a plant cell is a Group of answer choices vacuolar membrane. cell membrane. primary c
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!