1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
3 years ago
15

How will the fetus body temperature be regulated after birth??? Plz helppp

Biology
2 answers:
grin007 [14]3 years ago
4 0
The skin is the new born
dsp733 years ago
3 0
The skin of the newborn is very thin,and it has a special  form of regular temperature that is made by the metabolism of the so-called "brown fat". Brown fat is a special fatty tissue of the newborn that has a high capacity to produce heat through chemical reactions. The fat is distributed in different parts of the baby's body.

You might be interested in
Describe two traits that represent a sustainable society and two traits of a non sustainable society
scoray [572]
<h2>The correct answer is explained below:</h2>

Explanation:

  • A Sustainable society can be defined as the one which utilizes the various available resources in a judicious and economical manner such that the resources can be retained for a longer period of time to be utilized by the future generations. Two traits of such a society are:
  1. Follows the principle of 3Rs, that is Reduce, Reuse and Recycle. This means the society supports the reduction in overuse of resources, promotes the reuse of resources wherever possible and also supports the idea of recycling several resources to sustain the availability of fresh resources.
  2. Tries to harness and make the best possible use of the available renewable resources. The society tries to maximally utilize the renewable resources to fulfill their needs.
  • A Non-sustainable society can be defined as the one which uses all the available resources extravagantly and profusely without showing any concern over the amount of the resources available for the future. Two traits of such a society are:
  1. They tend to use the more readily available resources uncontrollably without any restriction and often not considering whether the resources are required immediately and essentially or not .
  2. They tend to waste a lot of resources as often harnessing resources to an extent which is more than the requirement of the resources causes the wastage of the excess resource.
4 0
3 years ago
What is the major type of stress that occurs at convergent plate boundaries?
ValentinkaMS [17]
<span>These are the three most common types of stresses that occur at different types of plate boundaries. 

Compression- convergent boundaries
Tension- divergent boundaries
Shear- transform boundaries 

Therefore, Compression, or compressing stress, is the major type of stress that occurs at convergent plate boundaries.</span>
3 0
4 years ago
Read 2 more answers
How many different genes does a human cell carry
Debora [2.8K]

Each cell in the human body contains about 25,000 to 35,000 genes.

7 0
3 years ago
A scientist observes an enzyme polypeptide chain arranged in spiral turns that rise upward and are held in place by hydrogen bon
marin [14]
If a scientist observes an enzyme polypeptide chain arranged in spiral turns that rise upward and are held in place by hydrogen bonds he/she is looking at a tertiary structural arrangement. 
3 0
4 years ago
Read 2 more answers
What happens during cell transformation
lubasha [3.4K]

Answer:

A cell takes in DNA from outside the cell then the external DNA becomes a component of the cell's DNA. ... a gene that makes it possible to distinguish bacteria that carry the plasma (and foreign DNA) from those that don't.

Explanation:

8 0
3 years ago
Other questions:
  • In a molecule of double-stranded DNA the amount of adenine present is always equal to the amount of ?
    8·2 answers
  • What would happen to the population of an animal if its food source were removed from the food web
    11·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • In garden peas, tall stem (T) is dominant over short stem (t), green pods (G) are dominant over yellow pods (g), and smooth seed
    8·1 answer
  • A substance that influences the reaction but does not participate in the reaction is a
    8·1 answer
  • A triglyceride is made up of three fatty acids and one molecule of _____.
    5·2 answers
  • Which of the following is an example of anatomy?
    13·1 answer
  • The rays of the Sun strike Earth most directly
    13·2 answers
  • The beaker below represents
    7·1 answer
  • What type of bonds are found between the 5-Carbon sugar of one nucleotide and the Phosphate group of the next?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!