1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katarina [22]
3 years ago
15

What is the main function of the endocrine system?

Biology
2 answers:
inna [77]3 years ago
5 0

Answer:

Hello, Here's your answer The endocrine system help control the body through chemicals

Explanation:

"The endocrine system is made up of glands that produce and secrete hormones, chemical substances produced in the body that regulate the activity of cells or organs. These hormones regulate the body's growth, metabolism (the physical and chemical processes of the body), and sexual development and function."

<em>Have a great day!</em>

ANEK [815]3 years ago
3 0

Answer:

your answer would be a, To control body activities through the release of chemicals

Explanation:

The endocrine system's basic purpose is to control body activities through the release of chemicals

You might be interested in
Every HIV particle contains two RNA molecules. If two genes from one RNA moleculebecome detached and then, as a unit, get attach
natita [175]

Answer:

One of the RNA molecules has experienced gene duplication as the result of translocation.

Explanation:

Translocation and duplication are some of the structural abnormalities in the chromosomes that may even cause certain genetic disorders. Duplication is the presence of a genetic segment for more than one time in the chromosome. The repeated genetic segments are mostly present in the tandem pattern. When a chromosome fragment breaks off and attaches to a non-homologous chromosome, it is called translocation. It leads to the deletion of a genetic segment in one chromosome and duplication in the other.

According to the given information, a genetic segment bearing two genes is detached from one RNA and gets attached to the other RNA molecule of the HIV genome. Therefore, the RNA molecule has undergone translocation and has lost a genetic segment while the other has gained a genetic segment (duplication) due to translocation.

5 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Please help. I have been struggling with this for two days and my teacher won't help me
goblinko [34]
What class is that and how you need help
3 0
3 years ago
Read 2 more answers
Which component is the last to join the initiation complex during the initiation of translation?
Vika [28.1K]

Answer:

The correct answer is the third option- the large ribosomal unit.

Explanation:

The translation is the second process of the protein synthesis in which transcribed mRNA molecule and transfer RNA or tRNA and ribosomes assemble together and complete synthesis of peptide chain or protein.

The assembly of initiator tRNA to ribosome subunits at the start codon of the mRNA is the initiation complex of the translation. The initiator tRNA is basically a met-tRNA molecule.

The initiator tRNA is bound to small subunit (30S) at 5' cap and scan for the start codon of mRNA.

Start codon bind to initiator RNA and in the end larger ribosomal unit assemble to this complex to complete the initiation complex of translation.

Thus, the correct answer is option - the large ribosomal subunit

6 0
4 years ago
Which two naturalists were responsible for the development of The Principle of Natural Selection?
antoniya [11.8K]

Answer:

Charles Darwin and Alfred Russel Wallace

4 0
3 years ago
Other questions:
  • The first organisms evolved on Earth around 4 billion years ago. The fossil record indicates that the first organisms were which
    7·1 answer
  • What could account for the differences in lines A and B in the graph
    15·1 answer
  • What is the function of oxygen in the human body? In other words why do we need<br> lit?/?
    11·1 answer
  • If all of the red squirrels were diseased and died off what would happen to this food web?
    12·1 answer
  • Why do scientists classify organisms?
    7·1 answer
  • All eukaryotic cells contain small bodies known as _______. Organelles lipids miniscules
    13·2 answers
  • John's class has been studying blood type and donations. John is not sure what blood type he has. At dinner, John asked him mon
    14·2 answers
  • 2. Cellulosic Biofuels are fuels that are produced by fermentation of cellulose containing materials (wood, leaves, paper, etc.)
    5·1 answer
  • Which is a density-dependent factor?
    7·1 answer
  • The binomial effect size display is a method for illustrating the size of:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!