1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
2 years ago
14

How are salts formed?

Biology
2 answers:
Blizzard [7]2 years ago
8 0
THE ANSWER IS D BY <span>intermolecular</span> HYDROGEN BONDING

Ivanshal [37]2 years ago
7 0

Answer: Option (C) is the correct answer.

Explanation:

When an acid and a base undergo a neutralization reaction then it results in the formation of an ionic compound known as a salt.

For example, NaCl is an ionic compound and it a salt as a salt will always be formed by a metal and a non-metal. The metal will always lose electrons and the non-metal will always gain electrons thus, resulting in the formation of ionic bond.

Thus, we can conclude that salts are formed by the ionic bonding of a cation and an anion.

You might be interested in
A student is studying the levels of organization in living things and creates a table to give examples of the different levels.
myrzilka [38]
A. Sparrow just took it on edg!
4 0
3 years ago
Read 2 more answers
Which natural methods remove CO2 from the atmosphere? respiration ofa. living organisms B.photosynthesis by plants C.evaporation
zysi [14]

Answer;

A) respiration of living organisms.

D)absorption of CO2 from the atmosphere by ocean water.

Explanation;

-The level of carbon dioxide in the atmosphere is maintained by several processes, including photosynthesis, respiration and combustion.

-Green plants remove carbon dioxide from the atmosphere by photosynthesis. Living organisms - including all plants and animals - release energy from their food using respiration. Respiration and combustion - burning - both release carbon dioxide into the atmosphere.

5 0
3 years ago
Read 2 more answers
Which process can increase the rate of greenhouse gas emissions into the atmosphere in response to a decrease in albedo?
Vesnalui [34]

B. Ice-albedo feedback

Explanation:

The ice-albedo feedback is one process that can significantly increase the rate of greenhouse emissions in response to a decreased albedo.

Albedo is the ratio of reflected light to incident light.

A decrease in albedo suggests that a surface is absorbing more light than it is reflecting. This is typical of areas with land cover and vegetation.

Areas with a high reflectivity have a high albedo. Snow, ice and polar regions are good reflectors of solar radiation. They have a very high albedo close to 100%. Much of the surface area is buried with ice.

Examples of greenhouse gases are carbon dioxide, methane, water vapor e.t.c

How does a low albedo relates to increase in greenhouse gas emission?

  • The ice-albedo feedback can substantially contribute to greenhouse gas emission.
  • The high reflectivity of ice causes long wave radiation to warm the air around a icy body in polar regions.
  • When ice melts, they leave land bare and exposed.
  • Melt water collects in pockets.
  • Exposed land leads to a decrease in albedo.
  • Organisms can thrive more in warm terrain.
  • Also, pockets of carbon dioxide gases trapped in ice is released.
  • Organisms release carbon dioxide into the atmosphere during cellular respiration.
  • Soils originally permafrost will become stable and this will encourage more human occupation of the area.
  • All these activities leads to an increase in the emission of greenhouse gases in an area with low albedo.

Learn more:

Greenhouse emission brainly.com/question/4580761

#learnwithBrainly

4 0
2 years ago
Which statement best explains why a plant cell has chloroplasts but most animal <br> cells do not?
irinina [24]

Answer:

Both animal and plant cells have mitochondria, but only plant cells have chloroplasts. Plants don't get their sugar from eating food, so they need to make sugar from sunlight. Because animals get sugar from the food they eat, they do not need chloroplasts: just mitochondria.

Explanation:

5 0
3 years ago
Read 2 more answers
2. Write the molecular formula of following Magnesium Chloride, Sodium chloride, potassium nitrate, hydrogen oxide ​
inna [77]

Explanation:

Magnesium Chloride : MgCl2

Sodium chloride : NaCl

Potassium nitrate : KNO3

Hydrogen oxide : H2O2.

hope this helps you.

5 0
3 years ago
Other questions:
  • What covers the ends of bones in adults?
    10·2 answers
  • In _____ of meiosis, homologous chromosomes pair
    11·2 answers
  • 40 POINTS
    9·1 answer
  • Creates and packages proteins
    13·2 answers
  • What type of molecules commonly end in "-ase"
    12·1 answer
  • Why do you think some people still become ill even after taking strong precautions against an illness, such as receiving a vacci
    7·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which piece of laboratory equipment would a student use if he wanted to view a living
    11·1 answer
  • Name which the organism(s) doing photosynthesis below.
    6·2 answers
  • What is the name for the rafflesia's organism
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!