Answer: Burning prairies can increase biodiversity because it provides food and shelter for a changing variety of wildlife.
Explanation: :)
Answer:
A
Explanation:
Photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The correct answer is Lysosomes
Lysosomes are used for digestion of materials in the cell.