Answer:
they give the nutrients to the primary consumers.
Explanation:
producers are like-plants that are consumed by deer/bunnies etc. All those nutrients will decrease at the upper levels at the food chain so they have to have enough nutrients to keep the animals alive and healthy. When the lion eats the deer ( it was an example) some of the nutrients and minerals that the deer ate from the plant will be consumed by the lion while its being eaten.
<em>Hope this helps:)</em>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
A because if you are going down deeper into the ocean, you are going farther away from the sun so it will become colder.
Gametes are reproductive cells that unite during sexual reproduction to form a new cell called a zygote. Sexual reproduction needs zygotes to reproduce that is why gametes are needed. Asexual reproduction doesn’t need gametes because there is only one parent and there is no fusion of gametes.
