First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
5 is a nucleotide 6 is RNA
Answer:
Relative age dating is the process of determining if one rock or geologic event is older or younger than another, without knowing their specific ages
Absolute age dating is measuring the physical properties of an object itself and using these measurements to calculate its exact age
Explanation:
<3
im sorry aboit the answer i poster my little brother got ahold of my phone