1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
4 years ago
8

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′

5′−GGCCCUUUUACCCGGUUUU−3′ 5′−GGCCCUUUUAGGGCCUUUUU−3′5′−GGCCCUUUUAGGGCCUUUUU−3′ a sequence of uracil–adenine RNA–DNA base pairs a palindromic region followed by a sequence of adenine residues in the RNA
Biology
1 answer:
Blizzard [7]4 years ago
4 0

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

You might be interested in
you may have read about alkaline diets that claim that you need to only eat alkaline foods in order to remain healthy according
hram777 [196]

Answer:

Mechanisms are activated where it is sought to lower the amount of free protons in the blood, that is, to reduce acidity, these mechanisms work between two large systems, the receptor system, the respiratory system and the renal system.

Explanation:

When a metabolic acidosis is entered, either by a food, or by a disease or even an intense physical activity, the lungs seek to generate hyperventilation, to increase the concentrations of oxygen in plasma and absolutely decrease the carbon dioxide concentration, thus not the blood becomes even more acidic.

On the other hand, the digestive system together with the sensory system, will warn this proprioception of the acidity of the plasma and will promote the dilution of these acids with a solvent, which is water, promoting the sensation of thirst.

Finally, the kidneys will seek to retain all the alkaline solutes to neutralize the physiological internal pH, and will release through the urine and the channels of acidic compounds, the products or acid metabolites to the external environment, that is, acid urine excretion.

8 0
3 years ago
For most substances, the distance between particles is smallest when the substance exists as what?
rewona [7]
I'm pretty sure this would be a solid because particles are the least spread out when they are in the solid state of matter
4 0
3 years ago
Read 2 more answers
In which situation would new technology be most likely to cause a change in an existing theory about new structures in a cell?
Jlenok [28]

Hey there! Your answer would be:

The new technology allows detection of a structure that could not be detected previously.

I hope this helps!

7 0
4 years ago
Read 2 more answers
How is food poisoning caused​
viktelen [127]

Answer:

Food poisoning, also called foodborne illness, is illness caused by eating contaminated food. Infectious organisms — including bacteria, viruses and parasites — or their toxins are the most common causes of food poisoning. ... Contamination can also occur at home if food is incorrectly handled or cooked

Explanation:

5 0
3 years ago
Which two body systems initiate the majority of the body's homeostatic responses?
dedylja [7]
Answer: nervous and endocrine system.
Central nervous system(CNS) is needed to send a signal to many organs to work. Damage in CNS can cause you to stop breathing. The endocrine system is keeping the body healthy by make sure that the blood concentration of glucose and other molecule is enough to sustain life, but not too much to cause damage.
5 0
3 years ago
Other questions:
  • When would be a good time in San Francisco to collect seashells? Explain your answer.
    6·2 answers
  • Nancy the neuron has just fired an action potential. Now she cannot fire another action potential until she resets her electrica
    12·1 answer
  • Energy is defined as the ability to what
    14·2 answers
  • Griffith's experiments with S. pneumoniae were significant because they showed that traits could be transferred from one organis
    12·1 answer
  • Cosmologists are scientists who study stars, galaxies, black holes, and other objects in the universe. In order to study the bil
    12·2 answers
  • Electromagnetic radiation is energy that travels in waves. Some examples of electromagnetic radiation are visible light, radio w
    15·1 answer
  • Mammals have backbones. Which word in the list below is a synonym for backbones?
    11·2 answers
  • Explain how a cladogram is constructed
    13·2 answers
  • Yes. very hood but dont knoe how pls help
    10·2 answers
  • 14
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!