Answer:
It would be B
Explanation:
Genes are segments of deoxyribonucleic acid (DNA) that contain the code for a specific protein that functions in one or more types of cells in the body. Chromosomes are structures within cells that contain a person's genes. Genes are contained in chromosomes, which are in the cell nucleus.
Answer:
Airways diameter can influence the airflow resistance.
Explanation:
Airflow resistance follows the same principle followed by the airway resistance. This is the resistance offered during the pulmonary blood flow.
Airways diameter affects the airflow resistance. If the diameter of airway is increased, the airflow resistance decreases and air can flow easily in the body. The decrease in the airway diameter (dilution) increases the airflow resistance of the blood artery.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
The air quality for miles because of all the ash released during the eruption and the lava flow can destroy a lot of plant and animal life on the area suronding the volcano
<span />
