1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wittaler [7]
3 years ago
9

You are studying with a classmate, who explains that increasing the amount of nutrients in a lake helps submerged, rooted aquati

c plants by providing them with the nitrogen and phosphorus they need to survive and reproduce. Which of the following should be your response to your study buddy?
A-You agree because all organisms need nitrogen and phosphorus, and waterways are naturally limited in those nutrients.B-You agree and point out that plants also benefit because the decrease in oxygen will kill aquatic fish and snails, some of which would otherwise eat the aquatic plants.C-You agree and point out that the resulting fish kill would further enhance the nitrogen and phosphorus levels in the lake, which would further enhance the growth of submerged aquatic plants, creating a positive feedback loop.D-You disagree and explain that plants cannot use the nutrients in the water because the plants do not have access to the nutrients.E-You disagree because the resulting increase in phytoplankton at the surface would inhibit sunlight from penetrating into the water, thus inhibiting photosynthesis in the submerged plants.
Biology
1 answer:
Nataly_w [17]3 years ago
5 0

Answer:

E-You disagree because the resulting increase in phytoplankton at the surface would inhibit sunlight from penetrating into the water, thus inhibiting photosynthesis in the submerged plants.

Explanation:

Eutrophication is the process wherein nutrients specifically phosphorus and nitrogen are present in excess in a water body such as a lake. The increased concentration of nutrients promoter the growth of cyanobacteria and algae such as phytoplankton.

The increased population of phytoplankton in surface water reduces the oxygen availability and clarity of water for the organisms present in deeper layers.  Also, reduced clarity of water limits the amount of solar radiations penetrating the surface water to reach the deeper layers.

Increased nutrient levels of the lake would rather inhibit the growth of submerged plants due to reduced availability of sunlight as caused by presence of phytoplankton in surface water.  

You might be interested in
If there is 5 liters of a 3 M solution, how many moles does the solution contain?
dimaraw [331]

V (volume) = 5l

c (molar concentration or molarity) = 3 M = 1 mol/l

c = n/V, where n is the number of moles or amount of substance

So: n = c * V = 3 mol/l * 5l = 15 moles


7 0
3 years ago
Is division of Cell's cytoplasm, after which the cell enter's G1 phase.
nikklg [1K]

Answer:

it is composed of the G1 phase

Explanation:

6 0
3 years ago
Urine is transported from the bladder to the outside of the body by the
pav-90 [236]
The answer is urethra.

It is known that the kidneys are responsible for filtration of metabolic wastes from the blood and form urine. Urine is transported through the ureters to the urinary bladder. From the urinary bladder, urine is transported to the outside of the body by the urethra.
8 0
3 years ago
How would I separate each mixture in a fish tank????
andrew-mc [135]
First,get something where you can get the fish and where you can fill it up with water then just start taking out the mixture with a small net

6 0
3 years ago
Read 2 more answers
A new microorganism has been isolated from hot springs in Yellowstone National Park. It consists of single cells, which appear t
ad-work [718]

Answer: B- Bacteria

Explanation: Bacteria are infinitesimal organisms that have single cells that grow in different atmospheres. They have an easily understood inside arrangement. Their cells are normally surrounded by two shielding coverings which are an external cell continuous vertical structure and a cell pliable sheet-like structure acting as a boundary inside. However, some bacteria do have a third shielding sheet furthest from the center named the capsule.

5 0
3 years ago
Read 2 more answers
Other questions:
  • what would be most likely to happen to a plant that had working chloroplasts and its cells but had taken and poison that kept th
    7·1 answer
  • Which of these species is not endangered today thanks to successful conservation efforts? bald eagle polar bear Bengal tiger lea
    5·2 answers
  • Active transport real life comparison???
    5·1 answer
  • 4. Your ability to steer a vehicle depends partly upon the condition of the vehicle's suspension.
    7·2 answers
  • When bacteria are inoculated into a new sterile nutrient broth, their numbers don’t begin to increase immediately. Instead, ther
    9·1 answer
  • Describe how you produced summated contractions with the isolated muscles and how you produced a tetanus contraction. explain ho
    7·1 answer
  • Describe how parent cells become two daughter cells
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Proteins help the body build new tissue, repair damage cells, and produce energy.
    15·2 answers
  • From your perspective, how does the frequency of the waves appear to change as the airplane approches and then passes you ?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!