1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
7

When a woman goes into labor during childbirth, the cervix expands which sends a signal to the pituitary gland to release oxytoc

in which results in more contractions which results in more oxytocin being released and so on. What is happening during childbirth?
A negative feedback loop.
Cell regulation
A positive feedback loop.
A neutral feedback loop
Biology
2 answers:
VladimirAG [237]3 years ago
8 0
A. Neutral feedback loop
sveticcg [70]3 years ago
3 0
negative feedback loop
You might be interested in
Each _______ organism typically hasto two different alleles for each gene.
Alekssandra [29.7K]
Each DIPLOID organism typically hasto two different alleles for each gene.
7 0
3 years ago
A research colleague has provided you with a single cell to identify. briefly describe the steps you would take to determine whi
Nataliya [291]
Out of the three domains, Archaea, Bacteria and Eukarya, the vital differences may be identified in order to classify the cell. Eukaryotic cells possess membrane-bound organelles; on the other hand, the domains archaea and eukarya contain cells are prokaryotic, so they do not have membrane bound organelles. Moreover, they also possess ester linkages in their cell membranes, which allow them to survive more extreme environments (especially true for archaea). By studying the cell membrane of the cell, distinction can be made.
3 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
In a cell with a high energy requiroment, which
viktelen [127]

Answer:

chromosomes..........

8 0
3 years ago
Which of the following statements is NOT true?
anzhelika [568]
Probably the fact that mutations are not a part of evolution because sometimes adaptions in a population happen because of mutations
3 0
3 years ago
Read 2 more answers
Other questions:
  • The veins and arteries are covered by striated muscle. true or false
    15·2 answers
  • Which is a function of the collecting ducts? which is a function of the collecting ducts? absorb electrolytes actively and water
    10·1 answer
  • Jake designed an experiment to demonstrate interactions between Earth systems. He tied a clear plastic bag firmly around some le
    8·2 answers
  • An allele whose trait always shows up in the organism when the allele is present.
    10·1 answer
  • Did john dalton use A
    5·1 answer
  • Melosis ____
    14·1 answer
  • The dynamo theory states that earths magnetic field is created in the later known as the
    7·2 answers
  • A plant with the dominant trait, wrinkled seeds, is crossed with a plant that has non-wrinkled seeds. All of the offspring are a
    12·2 answers
  • How does water move around the ocean?
    11·1 answer
  • What base is found in mRNA but not DNA?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!