1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dusya [7]
3 years ago
5

Enzymes in the _________ are primarily responsible for the metabolism of a drug.

Biology
1 answer:
GrogVix [38]3 years ago
4 0

Enzymes in the liver cells <span>but are also located in cells throughout the body or also known as Cytochrome P450 (CYP450) are endogenous proteins in individuals that act as drug metabolizing enzymes and also have endogenous enzymatic processes that are also used to make cholesterol, steroids and other important lipids such as prostacyclins and thromboxane A2 (metabolites of arachidonic acid).</span>

You might be interested in
The typical state of a neuron is the _____, but when electrical signals stimulate it to its threshold, the _____ is immediately
Sergio039 [100]
The answers, respectively, are:
resting potential; action potential.
5 0
3 years ago
Viral hemagglutination assays only work with certain types of viruses because
nignag [31]

Answer:

a. the virus must be able to cross-link red blood cells directly.

Explanation:

Viral hemagglutination assay is a method which is used for the quantification of the relative concentration of the viruses.

The principle on which the hemagglutination assay works is as follows:

  1. There are sialic acid receptors present on the surface of the red blood cells which will bind to the haemagglutinin glycoprotein present  on the surface of the viral particle. 
  2. Due to the binding of the sialic acid receptors with haemagglutinin particle there will be cross-linking of the red blood cells by the viral particles and a lattice formation will take place. 
  3. The lattice will remain suspended in the solution however if the concentration of the virus particles will be less, the lattice will settle down in the well. 

Thus, this method allows knowing the relative concentration of the virus. 

<em>Due to its basic principle of cross-linking this method works well for only a few viruses such as influenza virus. </em>

5 0
3 years ago
How are Earth’s organisms and crust interdependent?
sattari [20]
The Lithosphere contains all of the cold, hard, solid rock of the planet's crust, the hot semi-solid rock below the crust, the hot liquid rock near the center of the planet, and the solid iron core. The biosphere is the sphere that contains all of the Earth's living organisms. The organisms and crust interact through events between spheres, such as natural events like floods, shifts in the Earth's crust. Some event as such could create soil erosion resulting in decreased vegetation and increase death of organisms. <span>
</span>
5 0
3 years ago
Read 2 more answers
What is it called when you feel sick for being at home??
vesna_86 [32]

Answer:

yes

Explanation:

3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • The process by which water enters deep into the geosphere is ?
    9·1 answer
  • Name the final form of chemical energy produced by cells during cellular respiration
    13·1 answer
  • Porque os mamíferos tiveram tanto sucesso evolutivo?
    8·1 answer
  • Clinical trials occur under very specialized, controlled conditions that do not represent everyday life. generalizing the result
    7·1 answer
  • Beth broke her ankle bone. The doctor gives her a brochure on foods she can eat to help restore the health of her bones. Which e
    13·2 answers
  • Rhythmic contractions of the male and female reproductive structures occur during the _____ phase.
    15·1 answer
  • 35!!! POINTS A rectangle has sides measuring (6x + 4) units and (2x + 11) units.
    6·1 answer
  • DNA encodes proteins, specifying the amino acids that compose them. Which of the following is most similar to a protein as the p
    13·2 answers
  • arious impairments of the mind are commonly associated with old age. To what extent are these biological in origin? To what exte
    6·2 answers
  • Join <br>https://teams.live.com/meet/95183847411242​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!