1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pishuonlain [190]
3 years ago
13

What kind of cell will you find in a leaf of a tree that you wouldnt find in a fingernail

Biology
1 answer:
enyata [817]3 years ago
3 0
I'm pretty sure it's <span>chloroplasts</span>
You might be interested in
Can someone please help me I’m stuck on this question!!
Lina20 [59]

Answer:I think that answer is b

Explanation:

4 0
3 years ago
The adrenal medulla secretes epinephrine during sympathetic stimulation. which of the following statements describes why epineph
laila [671]
The same receptor that responds to norepinephrine also respond to epinephrine, increasing the action of both. Adrenal medulla is NOT affected by the parasympathetic division of the autonomic nervous system (ANS
6 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Type 3 claims explains why water levels mead have changed?
iragen [17]

Answer:i dont even know

Explanation:

4 0
3 years ago
1. There are 200 bones in the human body. 2. The skeleton is the structural arrangement of bones in the human body. 3. A bones a
Andrews [41]

Answer:

Salmat po

Explanation:

sorry i can send the answer he said "We dont use rude word here, please change"

6 0
2 years ago
Other questions:
  • The dead cells that act as "straws" inside the plant to pull water and nutrients from the soil is _____. xylem phloem cortex pit
    8·2 answers
  • Where can hiv-infected patients and their families find resources?
    6·1 answer
  • Cells lining the human respiratory tract have projections that help keep the passageway clean, moving debris and mucus up and ou
    8·2 answers
  • A neuron transfers information in the form of an electrical impulse true/false
    12·1 answer
  • Why were Victorian hat makers prone to mercury posioning
    14·1 answer
  • Vasculitis can cause blood to leak from damaged vessels, forming purple spots called ________.
    9·1 answer
  • Help please....:)
    12·1 answer
  • What day of the year marks the start of the spring season in the Northern Hemisphere when day and night are both about 12 hours
    6·2 answers
  • 1)Plants and animals need a sugar called glucose in order to make ————— energy in a process called————.
    12·1 answer
  • For what reasons could a theory be changed or replaced? Check all that apply.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!