A holdfast is a root-like structure that anchors aquatic sessile organisms, such as seaweed, other sessile algae, stalked crinoids, benthic cnidarians, and sponges, to the substrate.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
During bread making, metabolism of simple sugars by yeast produces carbon dioxide which makes the bread rise.
The essential ingredients of bread dough are flour, water and yeast. As soon as these ingredients are stirred together, enzymes in the yeast and the flour cause large starch molecules to break down into simple sugars.
The yeast metabolizes these simple sugars and exudes a liquid that releases carbon dioxide and ethyl alcohol into existing air bubbles in the dough. If the dough has a strong and elastic gluten network, the carbon dioxide is held within the bubble and begins to inflate it, just like someone blowing up bubble gum.
As more and more tiny air cells fill with carbon dioxide, the dough rises, and so we see bread rising.
Answer:
D
Explanation:
In multicellular organisms, the body is a system of multiple, interacting subsystems. Subsystems are groups of cells that work together to form tissues. Interactions are limited to the circulatory, excretory, digestive, respiratory, muscular, and nervous systems.
