1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
3 years ago
13

Best answer gets brainliest

Biology
1 answer:
maria [59]3 years ago
3 0

Answer: The person should steer around a breaking wave. This type of waves contains large amount of potential energy that is waiting to be transformed into Kinetic energy, In this case, it can impact the ship with tremendous force.

Explanation: Hope this help :)

You might be interested in
What are sessile algae?
Vedmedyk [2.9K]
A holdfast is a root-like structure that anchors aquatic sessile organisms, such as seaweed, other sessile algae, stalked crinoids, benthic cnidarians, and sponges, to the substrate.
3 0
3 years ago
Which of the following is a description of trait of a country with a high
Alona [7]
The correct answer is D
4 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
6) The Honeydough Bread factory produces 2,000 loaves of bread per day. During bread making, ____________ by yeast produces ____
diamong [38]
During bread making, metabolism of simple sugars by yeast produces carbon dioxide which makes the bread rise. The essential ingredients of bread dough are flour, water and yeast. As soon as these ingredients are stirred together, enzymes in the yeast and the flour cause large starch molecules to break down into simple sugars. The yeast metabolizes these simple sugars and exudes a liquid that releases carbon dioxide and ethyl alcohol into existing air bubbles in the dough. If the dough has a strong and elastic gluten network, the carbon dioxide is held within the bubble and begins to inflate it, just like someone blowing up bubble gum. As more and more tiny air cells fill with carbon dioxide, the dough rises, and so we see bread rising.
3 0
3 years ago
Read 2 more answers
Which of the following is a subsystem of an organism? Please explain and I give you 5 stars.
Alenkasestr [34]

Answer:

D

Explanation:

In multicellular organisms, the body is a system of multiple, interacting subsystems. Subsystems are groups of cells that work together to form tissues. Interactions are limited to the circulatory, excretory, digestive, respiratory, muscular, and nervous systems.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Which part of the brain includes the visual cortex, motor cortex, and other centers that are most highly developed for receiving
    15·1 answer
  • what would be the effect on the epsp if the concentration of the enzyme responsible for degrading the excitatory neurotransmitte
    11·1 answer
  • Which best explains why muscle cells are different from blood cells
    12·2 answers
  • The digestive system is critical to maintaining a healthy body because
    7·2 answers
  • Which of these scientists did not make a major contribution to cell theory?
    5·2 answers
  • 1) if new individuals with different colors migrated into your ecosystem, what would the effect be on the community if the ecosy
    8·1 answer
  • HELP PLEASE WILL GIVE BRAININESS!!!
    13·2 answers
  • Bianca laughed while eating cereal and ended up aspirating a piece of cereal. What<br> happening?
    5·2 answers
  • Why biology major uses APA?
    6·1 answer
  • Which of the following statements are true about the homologous chromosomes of a pair?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!