The west Nile Virus is pathogen which caused the West Nile fever and encephalitis. The pathogen was introduced in 1999 in the Western Hemisphere and infected a major population in new york. It then expanded to 12 states and district of columbia. The major carrier of the pathogen was Avian and Mosquitoes species. In between 1999 to 2008, nearly 2500000 people were infected and nearly 1500 people died. Also there were thousands of cases of encephalitis or meningitis.
Answer:
<u>Competition</u> describes an interaction in which two organisms that interact must use the same limited resources because they are competing for them.
Explanation:
The purpose of crime scene photography is to provide a true and accurate record of the crime scene and physical evidence present by recording the original scene and related areas.
Technology and industrialization are two top ones.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
