1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
3 years ago
8

The study of the early development of an organism and is quite often used to show similarites and differences

Biology
1 answer:
kogti [31]3 years ago
6 0
Embryology / Comparative Embryology
You might be interested in
Do annelids have internal or external shell?
n200080 [17]


Annelids have neither an external or an internal shell.  Examples of annelids are

earthworms and leeches. 

6 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Which of the following is an accurate statement of the relationships within this cladogram?
quester [9]

B. Clade 1 is ancestral to all the other clades

8 0
3 years ago
Can a catalyst be used over and over again?
Diano4ka-milaya [45]
Yes they can because the catalyst does not take part in the chemical reaction and remains unchanged after the reaction has ended.  Biological catalysts are known to be recycled by the bodies in which they work.
4 0
3 years ago
Which phase of mitosis is shown in the diagram?
Anika [276]
The answer is B) metaphase
3 0
3 years ago
Other questions:
  • 2. All genes are activated and expressed all the time.<br> True<br> False
    5·2 answers
  • What is the component of red blood cells responsible for oxygen transport?
    15·1 answer
  • What is the difference between independent and dependent variables
    5·1 answer
  • Biotechnology has resulted in the formation of food crops that are resistant to herbicides. How was this most likely accomplishe
    6·1 answer
  • Describe cultural effects and economic effects regards to population.
    7·1 answer
  • Chromosomes which contain DNA has several functions ALL BUT ONE of these statements is a function of chromosomes
    12·2 answers
  • Os protozoarios tambem sao chamados de? ​
    9·1 answer
  • What happens when a baby dies in the mothers womb do the docters just take the baby out? Or do they have to do a pressideur?
    10·1 answer
  • Which of the following describes the actions you will probably take when completing the "Propose a Design" step of the technolog
    6·2 answers
  • Submit your air quality report for your area, showing seven days, the air quality color for each day, and each day's major pollu
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!