1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
posledela
3 years ago
7

The __________ provides enzymes that allows the sperm to digest a pathway through the zona pellucida to the oocyte. chorion blas

tocyst zygote acrosome
Biology
1 answer:
Ivan3 years ago
5 0
The answer is Acrosome :)
You might be interested in
I need help quick please
LenKa [72]

Answer:

Polyploid cells have more than 2 sets of each chromosome. Hope that helped! :)

7 0
3 years ago
Read 2 more answers
How are DNA and growth/development related?
OLga [1]

Explanation:

Deoxyribonucleic acid (DNA)is a molecule composed of two polynucleotide chains that coil around each other and growth is the increase of size in a child while development is the process in which a child develops his or her skills

3 0
3 years ago
A woman is heterozygous for blue eyes. If she were to have child with a man who is homozygous recessive for brown eyes, what is
Katena32 [7]
It would me 50% because when you are born you take from one side or the other with hair and eye color
4 0
3 years ago
Read 2 more answers
Perception is:
Masja [62]
B) the ability to work top down bottom up



B it the answer Fasho
4 0
3 years ago
According to the endosymbiotic theory, some organelles are believed to have evolved through a symbiotic relationship between euk
Inessa [10]
The Mitochondria in many cells, are believed to have been bacteria that have been incorporated in the cytophysiology. Mitochondria first off, contain their own DNA, er, RNA. Additionally physiologically the mitochondrion, has an inner membrane and some organelle traits similar to prokaryotic cells. Lastly Mitochondria are the only organelle capable of replicating itself. <span />
7 0
4 years ago
Other questions:
  • How are food chains and food webs related
    10·1 answer
  • What does a pulley consist of
    11·2 answers
  • Using data from the table above, select the best explanation for why that cell will be able to eliminate waste most efficiently?
    9·1 answer
  • The cell cycle involves the growth, replication, and division of a eukaryotic cell. Mitosis most directly plays a role in
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What are two ways that prokaryotes provide nutrients to humans
    7·1 answer
  • You want to engineer a eukaryotic gene into bacterial colony and have it expressed. What must be included in addition to the cod
    6·1 answer
  • What would be a growth factor for a population of deer?
    8·1 answer
  • Where does epipelagic gets it energy and nutrients from?
    10·1 answer
  • Which of the following results when a sperm cell fertilizes an egg cell?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!