Answer:
a) Genes b and c are farthest apart.
Explanation:
Transformation occurs when a competent bacteria cell takes up genetic material from the environment. Usually a donor cell donates its gene fragment which is then incorporated into the chromosome or plasmid of recipient bacterial cell.
Cotransformation occurs when two genes are taken up together by the recipient. The closer the genes lie to each other, more are the chances of them being taken up together. Contransformation frequency will be higher if two genes are close to each other. Here, cotransformation frequencies between three genes are given. Amongst them, the lowest frequency is 0.0064% which is present between gene b and c. Hence, gene b and c are the farthest apart.
Answer:
Chloroplasts are the food producers of the cell. They are only found in plant cells and some protists. Animal cells do not have chloroplasts. Every green plant you see is working to convert the energy of the sun into sugars. Plants are the basis of all life on Earth. They create sugars, and the byproduct of that process is the oxygen that we breathe. That process happens in the chloroplast. Mitochondria work in the opposite direction and break down the sugars and nutrients that the cell receives.
Explanation:
Answer:
Air pressure is caused by the weight of the air molecules above
Explanation:
Air pressure is caused by the weight of the air molecules above. Even tiny air molecules have some weight, and the huge numbers of air molecules that make up the layers of our atmosphere collectively have a great deal of weight, which presses down on whatever is below.
Hmm, learning about this what a while back, but i would say (1)
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
