1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shepuryov [24]
3 years ago
8

An inner and an outer membrane are characteristic of which organelle?

Biology
2 answers:
photoshop1234 [79]3 years ago
7 0
The inner membrane is more imporant 
labwork [276]3 years ago
5 0
Mitochondria is the answer
You might be interested in
HELP FAST! PHYSICAL SCIENCE salt is added to a flask of water. the flask is sealed and shaken for several minutes.After being sh
densk [106]

Answer:the following can be done to allow more NaCl to dissolve;

1.) heating the mixture.

2.) Addition of extra water to the solution.

Explanation:

When sodium chloride is dissolved in water, the polar water molecules are able to work their way in between the individual ions in the lattice. The water molecules surround the negative chloride ions and positive sodium ions and pull them away into the solution. This process is called dissociation. Now when the solution is heated, the rate of the dissociation between the two molecules increases leading to more dissolution of NaCl. Also in the absence of heating, more Water molecules can be added to the solution to decrease it's saturation thereby favouring the dissolution of more NaCl.

6 0
3 years ago
What did Darwin discover about plants from his phototropism experiments?
mel-nik [20]

Answer:

https://www.biology-pages.info/T/Tropisms.html

Explanation:

This link holds all the information you need :D

7 0
3 years ago
How are the cell membrane and the cell wall similar?.
kirill [66]

Answer:

both permeable

Explanation:

the cell wall is fully permable however the the cell membrane is selectively permable, there's little to no similarities between them, mainly differences as they're from two different cells completely

4 0
2 years ago
Read 2 more answers
A neuron transmits information by the secretion of hormones. True or False
grandymaker [24]

Answer:

The given statement is false.

A neuron is the basic structural and functional unit of the nervous system. It helps in transmitting information from one neuron to another neuron, gland, or muscle cell.

The conduction of nerve impulse is electrochemical in nature. It transmits the impulse electrically through the axon the nerve cells and chemically through synapses (gap between two nerves cells).

The axon terminals of pre-synaptic nerve cell release chemical messengers (also called neurotransmitters) in the synaptic cleft. These messengers then bind to the receptors present on the post-synaptic nerve cell and regenerate the nerve impulse.

4 0
3 years ago
Read 2 more answers
True / False Trees are known as nonrenewable resources found on Earth.
Gelneren [198K]
True trees can be planted grown up harvested for timber
8 0
3 years ago
Other questions:
  • Proteins are an essential component of a healthy diet for humans (and other animals). their most common purpose is to serve as:
    12·1 answer
  • "What are the differences between the Federalists and Anti-Federalist in ratifying the Constitution?
    12·1 answer
  • Arrange the objects from smallest to largest in the solar system
    11·1 answer
  • Which characteristics of adaptive immunity ensures that vaccination effectively prevents disease?
    6·1 answer
  • Describe how the relationship between sickle cell disease and malaria is an example of natural selection in humans in 3 complete
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What blood vessel delivers oxygenated blood to the heart structure that separates the left and right ventricles?
    5·1 answer
  • .
    8·2 answers
  • 36. What are the two smaller tubes that branch off of the trachea?
    15·1 answer
  • What is the function of the Earth's atmosphere?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!