Oxygen and silicon make up most of earths crust
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Fourteen-year-old warren has undergone a rapid increase in height and weight. warren is experiencing the adolescent growth spurt
His age is around when adolescent growth spurt start. In this time, the growth hormone secretion is increased substantially, increasing the growth speed.
Answer:
Global climate change affects the distribution of species.
Explanation:
