1. A logging company plants two acres of land with
trees for every one acre of forest it removes -B. using resources sustainably-
2. Julia uses old glass jam jars as pots for
her plants-C. recycling resources-
3. Jackson installs a solar-powered water heater
to supply his house with hot water-A. using renewable resources-
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Temperate Rainforest and Tropical Rainforest
Answer: Fossil fuels are made up of dead plant life example trees, bushes, etc., and when burned they release carbon in the air
Answer:
C
Explanation:
Simple carbohydrates contain just one or two sugars, such as fructose (found in fruits) and galactose (found in milk products). These single sugars are called monosaccharides.
