1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
navik [9.2K]
3 years ago
14

On a cold day let the water in the pan freeze outdoor

Biology
1 answer:
Dafna11 [192]3 years ago
8 0
What do you mean? water freezes at 32 degrees F.
You might be interested in
The earth is composed of three different chemical layers core mantle and crust the formation of these layers was from a process
pickupchik [31]

incompatible elements


7 0
3 years ago
TRUE OR FALSE:<br><br> Selective breeding cannot be used to produce pest-resistant crops.
Usimov [2.4K]

Answer:

false

Explanation:

5 0
3 years ago
Where is having brightly colored feathers that attract mates most clearly an adaptation for a bird?
GREYUIT [131]
The correct answer would most likely be A
3 0
3 years ago
If a strand of DNA has 24% T, what percent will be G?
galben [10]
If one strand of DNA has 24% T, it would have 26% G.
7 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • Which term refers to the structure that forms the surface of a cell separating its contents from the outside world
    12·2 answers
  • Correctly order the steps involved cellular immunity:
    15·1 answer
  • Jacinta realizes she is starting to lose her battle with lung cancer. she keeps praying, "i just want to live long enough to see
    11·1 answer
  • Calculate the angle of impact for a blood droplet whose width is 6.8 mm and length is 7.2 mm.
    11·1 answer
  • Need this asap!!!
    15·1 answer
  • When a pregnant woman ingests toxins such as alcohol and
    15·1 answer
  • If a DNA molecule consists of 29% Guanine, how much cytosine will it contain?
    12·1 answer
  • In what ethnic group(s) is CF most common? ___________________________ How is CF inherited?
    5·1 answer
  • How do animals take in glucose?
    10·1 answer
  • 4. On the basis of what criteria did Linnaeus classify “natural bodies"<br> into his system?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!