the answer is D) repressor
Answer:
the use of prokaryotes to clean up pollutants
Explanation:
Bioremediation, also called biological remediation, is a technique used to minimize the environmental impacts caused by pollution.
In this process biological degrading agents are used, particularly microorganisms (bacteria, fungi, yeast, enzymes, etc.), which detoxify areas contaminated by pollution. That is, we can say that bioremediation includes the use of prokaryotes to clean pollutants.
In bioremediation, prokaryotes remove or neutralize various toxic pollutants (organic and inorganic) from the environment, which are present in soils, waters (surface or underground), among others.
The microorganism used in the biological remediation process metabolizes and digests the contaminant. Consequently, it releases carbon dioxide (CO2) and water (H2O). A notorious example where bioremediation can be used is in the contamination (of soils or water resources) by petroleum and its derivatives.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
The cardiovascular system is my best answer. hope this helped, have an amazing day gorgeous :)
Answer: THe answer is C for number 1.
The answer is A for number 2
Explanation:
