1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dominik [7]
3 years ago
6

What do the majority of scientists believe the greatest remaining mystery of climate change is?

Geography
1 answer:
lbvjy [14]3 years ago
4 0
The greatest remaining mystery of climate change is clouds effect.
You might be interested in
Why was the US detonation of a hydrogen bomb in 1952 and the Soviet detonation of one in 1953 significant?
allochka39001 [22]

Answer:

D

Explanation:

4 0
3 years ago
Read 2 more answers
IN YOUR OWN WORD
Rufina [12.5K]

Answer:

Insurance companies should have the ability to legally learn the genetic profiles of people that wish to be insured.

Explanation: The reasoning...

Insurance wise the more of a liability you are the more insurance companies might not want to provide insurance to you, and if in their own studies they should be permitted to find about any history of genetic illness, this followed by higher risks of cancer, and diabetes might make you a high-risk client. Insurance is something that is sold so that the possibilities can be dealt with. If a person has a higher risk of one of those medical possibilities that might cost the insurance company more than you pay the monthly cost. This is unsavoury for companies that work like this hence it should be in their right to allow for genetic profile background checks, funded by themselves of course.

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Sweden’s government encourages population growth through all of the following measures except __________.
DiKsa [7]
It’s D. I almost positive that no country in the world forces reproduction :)
8 0
3 years ago
Which line serves as the boundary line between one day and the next?
skelet666 [1.2K]

Answer:

A. the international date line

4 0
3 years ago
Other questions:
  • What is California capital?
    13·2 answers
  • The region of the world that was likely occupied last by early humans was north america. true false
    15·1 answer
  • What is the geologic history that created the blue ridge mountains
    15·2 answers
  • Lake ___ has the longest shoreline of all of the Great Lakes.
    11·2 answers
  • In which layer do light gases escape Earth's gravity?
    5·1 answer
  • Which evidence helps scientists understand the physical properties of Earth's internal structure?
    8·1 answer
  • A cross-section of a river bank before and after an erosion event is shown below. soil being eroded on a river bank What is the
    9·1 answer
  • 2. What country had the lowest GDP per capita? Why do you think that is?
    11·1 answer
  • In the concentric zone model, which of these would be most likely to locate closer to the city center?
    11·1 answer
  • How was power distributed in ancient india?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!