1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KengaRu [80]
4 years ago
8

Why is ATP important?

Biology
1 answer:
Rudik [331]4 years ago
8 0
Chemically, ATP is an adenine nucleotide bound to three phosphates. There is a lot of energy stored in the bond between the second and third phosphate groups that can be used to fuel chemical reactions. When a cell needs energy, it breaks this bond to form adenosine diphosphate (ADP) and a free phosphate molecule.
You might be interested in
What two species are most closely related from the evolutionary tree
Vedmedyk [2.9K]

Answer:

Species a and c

Explanation:

The species c, was more closely related to species a than species b was. This is because species a and c just recently evolved into different species in evolutionary history.

4 0
3 years ago
What membrane activities requires energy from atp hydrolysis?
NikAS [45]

Answer:

active transport, like Na + ions leaving the cell

Explanation:

The active transport requires an energy expenditure to transport the molecule from one side of the membrane to the other, but the active transport is the only one that can transport molecules against a concentration gradient, just as the diffusion facilitated the active transport is limited by the number of transport proteins present.

Two major categories of active, primary and secondary transport are of interest. The primary active transport uses energy (generally obtained from ATP hydrolysis), at the level of the same membrane protein producing a conformational change that results in the transport of a molecule through the protein.

The best known example is the Na + / K + pump. The Na + / K + pump performs a countertransport ("antyport") transports K + into the cell and Na + outside it, at the same time, spending on the ATP process.

The secondary active transport uses energy to establish a gradient across the cell membrane, and then uses that gradient to transport a molecule of interest against its concentration gradient.

8 0
4 years ago
The image shows EKGs of a person with normal heart waves and of a person having tachycardia. Based on this image, what kind of c
hjlf
Tachycardia is a condition when the heart rate is greater than 100 beats per min at rest. The electrocardiogram is a diagnostic tool that measures and records the electrical activity of the heart. Bradycardia on the other hand is when the heart rate is slower than normal. The Tachycardia and bradycardia can arise from either the SA node or from other areas of the cardiac.
7 0
3 years ago
Read 2 more answers
list 5 animals that live in the desert. Write a paragraph telling me how they can survive in this particular biome. What feature
NARA [144]

5 desert animals are camel, sand cat, desert tortoises, desert lizards and the great road runner.

<u>Explanation:</u>

  • Camel has several physiological and behavioral adaptations that help them survive the extreme conditions of the desert. They have flat feet to help them spread their weight in the sand.
  • They have thick eyelashes and closeable nostrils to prevent the entry of sand. They store fat on their humps that supplies energy during long journeys and has a long large intestine which increases water reabsorption.
  • Sand cat is similar to the domestic cat in basic appearance but has several adaptations enabling it to survive in the desert. Their paws are covered with thick and long hairs to protect the feet from the heat. They have thick fur that acts as an insulting surface during hot days and cold nights.  
  • Desert tortoises have excellent water storage capacity. Their bladders are larger than normal and can carry extra water. They have strong feet which helps them to dig holes in the sand and access rainwater.
  • Desert lizards can drink water through skin. They do it by a process called cutaneous water acquisition and it helps them to gather water obtained from rainfall, damp sand and pools.
  • Great roadrunner has peculiar adaptations. The digestive system of the bird retrieves water from the feces as it is in the excretory canal.  
4 0
4 years ago
What is the relationship between temperature and kelp productivity?
jasenka [17]

Answer: As the temperature of the water goes up, the amount and spatial extent of the kelp goes down. These changes could result in dramatic habitat loss leading to reduced ecosystem productivity and the extinction of many invertebrate species.

3 0
3 years ago
Other questions:
  • Describe the relationship between bird species richness and tree species richness
    6·2 answers
  • Could someone please help me with this answer thank you!
    15·1 answer
  • What energy storing molecule(s) are produced by the Krebs Cycle that go to the Electron Transport Chain?
    8·2 answers
  • Genetic engineering is the manipulation of genes using cloning and transformation to change the gene structure. Genetic engineer
    15·2 answers
  • How does a pluripotent cell differ from a totipotent cell?
    15·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Territorial behavior does not extend to organisms of different species. True or False
    9·1 answer
  • What is the role of a molecule that controls a repressible operon??
    14·1 answer
  • Name<br> 19. Identify each of the four phases of mitosis pictured below.
    6·1 answer
  • What did the miller- Urey experiment demonstrate?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!