1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
34kurt
3 years ago
5

1. For this task, you will imagine that you are a reporter for a scientific magazine. Your task is to explain the process of pro

tein synthesis to someone who does NOT have a science background. Therefore, the explanation needs to be in simple enough terms for anyone to understand. 3. You must also include the following terms: - Double helix - Helicase - Codon - Polymerase - 5’ cap - Poly (A) tail - Introns - Exons - Splicesomes - rRNA, tRNA, mRNA - Ribosomes - Anticodons - E site, P site, A site - Initiation - Elongation - Termination
Biology
1 answer:
JulijaS [17]3 years ago
3 0
All cells as we can say they work through their proteins. The work of proteins is being characterized by their sub-atomic capacity, contribution to a specific natural process and limitation inside. Segments of protein work which are being characterized by the correct synthesis, adaptation of proteins and structure which are being scrambled in the DNA area which is another name is called locus encoding the protein.
New proteins are being produced by the procedure of protein combined with organic cells, which are adjusted by the loss of protein cell through corruption. The RNA which is duplicated in protein hereditary data is encoded in DNA atom which is being created in the core known as RNA or mRNA. mRNA encodes data which is for solitary protein and is considered little in estimate by contrasted with DNA atom. This makes work easier for mRNA particles to leave the core passing through some small openings called atomic pores.
It leaves the core and goes straight to the cytoplasm. mRNA interferes with cell structure referred to as ribosome and fills in as cells contrasting agent within the procedure of protein union. Ribosome comprises of ribosome RNA particles or rRNA and proteins which are sorted out into two subunits.
When a small subunit is being accused of tRNA and corrosive amino acid methionine experiences mRNA which begins to begin flag.
When beginning succession AUG is found then the codon for corrosive amino methionine where substantial subunits join the little one to frame and hole ribosome where now protein amalgamation starts.
Following the codon downstream of AUG codon, the elongation of tRNA and amino corrosive enter to the ribosome. tRNA with wrong amino corrosive and wrong anticodon enters ribosome it is rejected because it can not base pair with mRNA.
The ribosome then propels on triplet and amino corrosive and tRNA enters the ribosome and method is then rehashed. In the termination, the ribosome achieves all the stop codons. Post-translation modification alludes to the covalent and leads to large enzymes change of proteins following biosynthesis of protein PTM happens in any progression within the life cycle of protein.
Protein in PTMs can be reversed depending upon the idea of change for example kinases phosphorylate of protein at a certain amino corrosive side chains phosphatases hydrolyzes phosphate where they gather and expel it from protein.
You might be interested in
Most of a cell's molecules can be classified as belonging to one of four major classes: lipids, carbohydrates, nucleotides, or a
goblinko [34]

Answer:

Diagram, in attachments

Explanation:

From the left side of the screen to the right,that is from a structure with a sugar structure with two other molecules  attached to it.

The first molecular structure is Nucleotides. Reasons it contains the middle ribose sugar(5-carbon)connected to the phosphate group and  Nitrogenous bases.This is the structure of nucleotides  and when this is joined by phosphodiester bond between one a nucleotide, to the phosphate group of another  nucleotide molecule  it forms a nucleic acid molecule.

The second structure from left to right with  long carbon chains, it is  a lipid.That js an Ester formed from the reaction of fatty acids with alcohol glycerol.

However, the presence of Phophate group in structure makes it different from a normal tryglycerides.The phosphate group has replaced  one of the  the three fatty acid molecules.Therefore it is called Phospholipid.With one hydropholic ends(phosphate ends) and the hyrophobic end the  carbon chain,with one unsaturated. The lipids molecules are held together my ester bonds.

The next structure is the protein structure(dipeptide).Genrally amino acid is made up of the central Alpha carbon connected on the right by the Carbonyl group(coo-) on the left by the Amine(NH2) group.The R-group which determines the type of amino acids  and hyrdogen atom.In the above structure condensation reaction  has occurred between the hydrogen atom  of  the amine group and carbonyl group of the other amino unit to form a dipeptide.The  bond formed from the condensation is the peptide bond.

The last structure on the far right are the carbohydrate -ring structure and the straight chains.The functional groups of the CHO  -Carbonyl group and hydroxyl group are glues to this.

3 0
3 years ago
Laboratory experiments, observational field studies, and model-building are all examples of different forms of scientific invest
Volgvan
Laboratory helps you identify things rather than the others using controlled variables 
3 0
3 years ago
Read 2 more answers
1. Why does the moon go through Phases?
liq [111]

Explanation:

1.The Moon has phases because it orbits Earth, which causes the portion we see illuminated to change. The Moon takes 27.3 days to orbit Earth, but the lunar phase cycle (from new Moon to new Moon) is 29.5 days. The Moon spends the extra 2.2 days "catching up" because Earth travels about 45 million miles around the Sun during the time the Moon completes one orbit around Earth.

2.

An eclipse is the result of the total or partial masking of a celestial body by another along an observer's line of sight. Solar eclipses result from the Moon blocking the Sun relative to the Earth; thus Earth, Moon and Sun all lie on a line. Lunar eclipses work the same way in a different order: Moon, Earth and Sun all on a line. In this case the Earth's shadow hides the Moon from view.Lunar and solar eclipses occur with about equal frequency. Lunar eclipses are more widely visible because Earth casts a much larger shadow on the Moon during a lunar eclipse than the Moon casts on Earth during a solar eclipse. As a result, you are more likely to see a lunar eclipse than a solar eclipse.

3.Why Do We have Seasons?

As the earth spins on its axis, producing night and day, it also moves about the sun in an elliptical (elongated circle) orbit that requires about 365 1/4 days to complete. The earth's spin axis is tilted with respect to its orbital plane. This is what causes the seasons. When the earth's axis points towards the sun, it is summer for that hemisphere. When the earth's axis points away, winter can be expected. Since the tilt of the axis is 23 1/2 degrees, the North Pole never points directly at the Sun, but on the summer solstice it points as close as it can, and on the winter solstice as far as it can.

Why Do the Seasons Change on Earth?

Two things cause the seasons to change. First, the Earth moves around the Sun. Second, the Earth has a tilted axis of rotation.

The Earth spins around an axis. This imaginary line extends from the South Pole to the North Pole. But the Earth’s axis is not vertical. It’s actually tilted at an angle of 23.5°. The planet is always tilted in the same direction as it orbits the Sun.

4 0
2 years ago
The examination of blood film should be performed at _____ to detect microfilariae.
amid [387]

Answer:

Night

Explanation:

Usually, a microfilariae blood test is conducted at night to coincide with the appearance of microfilariae.

8 0
1 year ago
Is hepatitis B the most common bloodborne pathogen?
IrinaK [193]

Answer:

No.

Explanation:

Hepatitis C is the most common bloodborne pathogen.

Hepatitis C as of 2022 has a infection rate of 3.7 million.

Hepatitis B as of 2022 has a infection rate of 2.2 million, or <em>1.5 million</em> lower than Hepatitis C.

Therefore, Hepatitis B is not the most common bloodborne pathogen.

Learn more about Hepatitis B, here:

brainly.com/question/6284143  - The three bloodborne pathogens healthcare workers in the US are most likely to be exposed to.

5 0
1 year ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How do I compare and contrast light dependent and light independent
    11·1 answer
  • All of the following are found in a chloroplast EXCEPT?
    13·2 answers
  • How does artificial selection provide evidence that species can change over<br> time?
    8·1 answer
  • True or false?<br> with explanation
    15·1 answer
  • What are the current infection rates of HIV across the globe
    8·1 answer
  • The DNA molecule is made up of numerous genes. true or false
    12·2 answers
  • Heeeeeelp please <br><br><br><br>Answer and I will give you brainiliest <br>​
    5·1 answer
  • Which molecule is used to tell tRNA which amino acid is needed?
    6·2 answers
  • A geneticist crossed fruit flies to determine the phenotypic ratio. The geneticist crossed a fly with blistery wings and spinele
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!