1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
3 years ago
9

The _________ deepens the socket of the hip joint and helps stabilize the joint.

Biology
1 answer:
vodomira [7]3 years ago
8 0
<span>acetabular labrum

This is a ring of cartilage that surrounds the acetabulum</span>
You might be interested in
Which type of relationship exists when a certain type of trees roots need a fungus present in order to grow normally
Ulleksa [173]
I am guessing an Ecological Relationship as it is dependent on it's environment
6 0
3 years ago
What are the similarities between cartilage and bone?<br><br> (It is a short answer question)
aleksley [76]

Answer: Cartilage and Bone are specialised forms of connective tissue. They are both made up of cells embedded in an extracellular matrix.

hope this helps :D

love your pfp btw :3

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
dogs once covered the expanses of the Great Plains. Their grazing made the grass more nutritious for the huge herds of bison, an
AysviL [449]

Answer:

The correct option is D, that is, THEIR FUNDAMENTAL NICHE HAS BEEN COMPROMISED.

Explanation:

From the information given in the question, we are told that the expanses of the Great Plains, which was once occupied by the prairie dogs have been reduced in size due to increased housing and agricultural developments. This implies that, the habitat, which is natural to the prairie dogs has been reduced in size, in another word, their fundamental niche has been compromised.                                                                                                                                                      

6 0
3 years ago
What is the difference between cross-sectional and longitudinal research?
Oksi-84 [34.3K]
I think the answer is either B or C, hope this helps! Sorry if it doesn't!
7 0
3 years ago
Read 2 more answers
Other questions:
  • The relationship between humans and their bacteria can be described as
    12·1 answer
  • DNA replication involves the activity of various enzymes. Which of these enzymes is correctly paired with its function?a.dna pol
    10·2 answers
  • In order for an statonary object to move, an unbalnced force must act upon it.<br> True<br> False
    14·1 answer
  • What is the similarity between simple diffusion and facilitated diffusion?
    10·2 answers
  • Match the following: A) Smooth muscle B) Skin epidermis C) Tendon D) Cardiac muscle 17) Derived from mesenchyme. ___________ 18)
    9·1 answer
  • Mention any two of the functions of proteins in animals​
    13·1 answer
  • Ima mark brainliest for real answer and thank you plz help
    12·1 answer
  • Which marks the beginning of the fall season
    10·1 answer
  • If you follow the scientific method, what happens after you make a hypothesis?
    6·1 answer
  • Describe 2 ways a red blood cell is adapted to carry oxygen in the human body
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!