1 <span>mild temperatures
</span>2 <span>large variety of grasses and shrubs
</span>4 <span>ideal for growing wheat, corn, and barley</span><span>
</span><span>6 moderate rainfall</span>
are the correct answers i believe.
D is probably right cos you are comparing data
Food cant move unless psychically moved by a human so thats the potenial energy it is not stored any were.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
