This family of ATPases is structurally related to the pumps that acidify lysosomes and vesicles; however, they usually function in reverse, generating ATP from ADP and Pi using proton gradients across membranes is called F-type pumps.
- The inner membrane of mitochondria and bacterial plasma membranes both contain F type pumps, which are necessary for the generation of ATP.
- It is also known as the ATP synthase complex or Complex V. By letting these protons passively return to the matrix, they use the proton gradient created by the flow of electrons to produce ATP.
- The F1 motor is the ATP turnover motor and,
- In mammals, the F0 motor, which is in charge of ion translocation, has nine subunits, nine of which are likely centered on the membrane's A, B, and C subunits, along with D, E, F2, F6, G2, and 8 subunits.
learn more about ATPases here: brainly.com/question/13914625
#SPJ4
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Haversian canals are bone structures that contain blood vessels that provide materials for the osteocytes
Explanation:
Through this Harvesian canals, blood vessels that contain the necessary nutrients for their growth and development are brought which keeps them alive
Answer:
C) cell bodies of sensory neurons
Explanation:
The dorsal root ganglia mainly contain cell bodies of sensory neurons.
See attachment for better visual understanding.
