1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jolli1 [7]
3 years ago
15

Why is it said that the earthworm has a closed circulatory system?

Biology
1 answer:
Ratling [72]3 years ago
7 0
The earthworm has a closed circulatory system. An earthwormcirculates blood exclusively through vessels. There are three main vessels that supply the blood to organs within the earthworm. These vessels are the aortic arches, dorsal blood vessels, and ventral blood vessel
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
NEED THIS ASAP ill mark brainliest Explain how the medical community can use computer-modeling tools, like the one shown in the
lorasvet [3.4K]

Answer:

here u go

Explanation:

<em>The modeling tool shows exactly how different body parts form. Doctors can use models, like the one in the video, along with ultrasound pictures of a developing baby, to determine whether the embryo is growing normally and is forming the proper body structures at the correct time. If not, the doctor could inform the parents of the problem before the baby is born. Doctors could then make a plan to treat the condition, if possible.</em>

3 0
2 years ago
As the human population continues to grow, humans cut down trees to build homes, shopping malls, and roads. Which part of the wa
Elan Coil [88]

Answer:Transpiration

Explanation: water cycle is the continuous movement of water on the Earth to ensure the availability of water.water is a universal solvent that is essential for the survival of living things.water cycle ensure that clean water is available.plants require water which is gotten from the soil.water is lost from the leaves of trees through transpiration.transpiration may also occur through the lenticels and stomata of stems.

the movement of water through the plant is called transpiration pull.this is responsible for the pull of water into the leaves.it increases the absorption of minerals from the soil and also cools the plant.

This water vapour that transpire from the plant,is condense as clouds, which then falls to the Earth as rain and the water cycle continue

3 0
3 years ago
Please help me I beg youuuuuuu!!!
Annette [7]

Explanation:

Risks:

may lead to a lack of variety in plant or animal species

The nutritional value of foods can be less

Benefits:

faster than natural selection

More selective breeds / Types

8 0
3 years ago
What is the base-pairing rule for DNA?
Crank
Each parent give you 23 chromosomes
4 0
3 years ago
Other questions:
  • What would result from a significant reduction of the insect population by insecticides?
    14·1 answer
  • Fat and ATP e different molecules that can both be described as molecules that store energy. Compare the functions of these mole
    12·2 answers
  • The chemical reactions of the ___ occur in the grana
    5·1 answer
  • In the ocean winds determine what?
    14·2 answers
  • What activity/activities contribute(s) to making the human species the most significant agent of environmental change on Earth
    8·2 answers
  • Fungi have many uses including commercial uses. Which of these is a commercial use for fungi? A. producing flavors for cheese B.
    7·2 answers
  • When zebrafish eggs are laid, they are surrounded by a tough chorion. Sperm are unable to get through this chorion and must find
    7·1 answer
  • Drinking alcohol during pregnancy negatively impacts development of the fetus because:
    9·2 answers
  • What is the normal respiration rate for horses, in breaths per minute?
    5·1 answer
  • What is measurement ?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!