1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Annette [7]
3 years ago
15

Kelly wished she were talking to her friend Carmen. What is the mood of the underlined verb in the sentence? A- imperative B- in

dicative C- subjunctive D- declarative
Biology
1 answer:
Lelu [443]3 years ago
7 0
The answer is C.......
You might be interested in
Which individual has a valid reason to take a vitamin/mineral supplement?
Ganezh [65]

Answer:

If the have a vitamin deficent or anemia as well as a doctor remoceded them increase in their viamin intake.

Explanation:

4 0
3 years ago
Sexual reproduction is important for the survival of the species for all but one of these reasons
n200080 [17]

C. It's necessary for the survival of the individual

5 0
3 years ago
Select all that apply. In gymnosperms, pollination can occur by _____. bees
MaRussiya [10]
The wind and pollen dropping from trees

3 0
3 years ago
Read 2 more answers
Osmosis occurs when there is a different concentration of solute molecules
mamaluj [8]
The osmotic potential within the cell is greater than the outside because the solution in the cell is less concentrated. Therefore, the water from inside the cell will move outwards due to the difference in potential via the process of osmosis. The cell becomes plasmolysed, or shrinks, due to the loss of water. 
6 0
3 years ago
The element _____ is not one of the four most common in your body
xeze [42]
Nitrogen is not found in your body because i think its dangerous,at least liquid nitrogen is
4 0
3 years ago
Read 2 more answers
Other questions:
  • What are the two functions of the tnp gene in pvjt128?
    5·1 answer
  • Trabecular bone has a faster turnover rate than cortical bone. trabecular bone has a faster turnover rate than cortical bone.
    14·1 answer
  • See Hint Motor neuron degeneration occurs in several diseases and leads to loss of muscle control. One form of motor neuron dege
    5·1 answer
  • Unlike DNA, RNA contains
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Is The Following Sentance True Or False: Common Sense was published in Philadelphia in January 1776. Within months, 120,000 copi
    14·1 answer
  • Help plsbi dont understand help pls​
    9·1 answer
  • Cell membrane is considered because it regulates what goes in and out of the cell
    12·1 answer
  • Is solar power renewable<br>​
    13·2 answers
  • What is the purpose of mitosis?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!