1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
2 years ago
15

Is the answer B? I just want to check my answer

Biology
2 answers:
nydimaria [60]2 years ago
7 0

Answer:

I personally think its C or D

Explanation:

As far as I can tell neither the original mother or father had any disease but it came about in the generations after them so either they were carriers and they passed it on or the younger generations got the disease another way

bezimeni [28]2 years ago
5 0

Answer:

i think its A

Explanation:

there are no affected females on the chart

You might be interested in
The deepest ocean trenches have high salt concentrations that can reach upwards of
kykrilka [37]
Trench
A long , narrow depression of the sea floor formed where a subdcting plate sinks into the mantle
Hope you get it!
7 0
3 years ago
Que caracteristicas comparten todas las celulas eucariotas ?
Olenka [21]

Explanation:

Las células eucariotas son muy diversas en forma, forma y función. Sin embargo, algunas características internas y externas son comunes a todos. Estos incluyen una membrana plasmática (celular), un núcleo, mitocondrias, orgánulos unidos a la membrana interna y un citoesqueleto.

4 0
3 years ago
The mass extinction occurring today differs from those that occurred in the past because
ahrayia [7]
The main reason for the difference in the mass extinction occurring today and previously is the pace of the current extinction. The extinction is taking place globally and involves hundreds of species at the same time. In less than 50 years, we have lost numerous species. In contrast to this, previously during the mass extinction, only a few species were lost, and other managed to survive. But, not the status is opposite due to the magnitude of the extinction. 
3 0
2 years ago
Read 2 more answers
Which statement best explains how the rock shown in this photo was deformed​
meriva

Answer:

B. Stress caused by forces that stretch an area of the crust made the rock to break

Explanation:

From the picture inserted to this problem, we see a unit that has been severely fractured.

Fracturing results from the brittle deformation of a rock under applied stress.

  • Rock fracturing results in the formation of joints and faults.
  • We can obviously see different sets of joint sets on the body of the rock in the picture attacked.
  • Also, a prominent fault which resembles an extensional fault can also be seen.
  • Therefore, the stress caused the stretch of the area which in turn makes the rock the rock to break.
6 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • A group of biology students tests the growth of bacteria under different conditions. The students apply the same amount of bacte
    10·2 answers
  • How is a egg cell adapted
    12·1 answer
  • If a foreign gene is cloned into an expression host, it is important that the host itself A) not produce the protein being studi
    8·1 answer
  • Scientists discovered a fossilized cockroach trapped in amber, which was supposed to be about 50 million years old. DNA fingerpr
    9·1 answer
  • Which is an example of competition within a species?
    8·1 answer
  • Difference between homology and heterology?
    11·1 answer
  • How does a wave affect energy? How does a wave affect matter
    6·2 answers
  • During an action potential, which of the following changes significantly? Group of answer choices
    9·1 answer
  • How does photosynthesis affect the flow of energy in a biosphere?
    12·2 answers
  • Give an example of an acid you can drink?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!