1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gwar [14]
4 years ago
12

The energy available at the trophic level that forms the base of an energy pyramid is 5,000 kilocalories. How much energy is ava

ilable at the trophic level that has secondary consumers?
A. 500 kilocalories

B. 50 kilocalories

C. 5 kilocalories

D. 0 kilocalories
Biology
1 answer:
Nuetrik [128]4 years ago
6 0
I guess is letter A-500 kilocalories
You might be interested in
Which strand of mRNA would be made during transcription using the DNA
Dominik [7]

Answer:

CUAGGC.

Explanation:

G:C

C:G

A:U

T:A.

3 0
3 years ago
What causes the line indicated by the arrows most likely represent?
Aloiza [94]

Answer:

the answer Is high pressure

8 0
3 years ago
Mrs. smith presented to her physician's office for an office visit for an upper respiratory infection. the physician examines th
valina [46]

Correct answer: Modifier 25

Modifier 25 is used to report an evaluation and management service that is significantly unrelated to the surgical procedure performed by the same physician on the same day and the minor procedure was not planned but rather happen as a spontaneous decision made at the time of the physical examination.

7 0
4 years ago
Ginny wants to use an ax to chop wood for a fire. The head of an ax is a wedge that cuts into wood and breaks it apart. Which ax
telo118 [61]

Answer:

Explanation:

I think C

3 0
3 years ago
Read 2 more answers
A cell plate is forming across the middle of a cell and new nuclei are forming at the poles. What kind of cell is this
Natali5045456 [20]

Answer:

Answer:It is a plant cell.

8 0
3 years ago
Other questions:
  • What is the overall chemical reaction for photosynthesis? in which organelle does photosynthesis occur?
    13·1 answer
  • Which statements describe characteristics of Earth's geosphere? Check all that apply. 
    13·2 answers
  • Enzymes work best at?
    15·2 answers
  • How is cocaine used?
    8·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • A brief paragraph explaining the role of specialized cells in humans?<br><br> 30 points
    10·1 answer
  • This is the method of researching or studying a topic. Examination, inquiry...
    7·1 answer
  • Scientists studying hair samples can tell how long it has been since someone dyed or bleached their hair.
    13·1 answer
  • A boy drank 750 cm3 of water. His total intake of water for that day was 3000 cm3. Calculate the percentage (%) of the boy’s tot
    7·1 answer
  • Energy in Ecosystems
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!