We humans are affecting the global food supply because of climate change. As you know the world is super polluted and threat of climate change is the collapse of food systems: Other threats — flooding, storms, forest fires — may be more sudden and severe in certain regions, but disruptions in food supply will affect virtually everyone.
According to sources, the most probable answer to this query is that nephrons found in the kidney are responsible for filtering out waste in the blood cells. The resulting product is urea.
This is then excreted to the body.
Thank you for your question. Please don't hesitate to ask in Brainly your queries.
The brain is incorrect. Its the nucleus (the brain is an organ not a organelle)
hope that helps :)
Answer:
If T=tall and t=short, what will be the physical appearance of the offspring in the cross?
Explanation:
It looks like your question is incomplete, so I'll try to fill in the blanks.
The offspring will depend on the parents. Each parent will need two alleles, so each parent would have to be TT (tall), Tt (tall) or tt (short--this is the only way to have a short individual).
Here are all the possible crosses:
TT X TT = 100% TT (all tall)
TT X Tt = 50% TT, 50% Tt (all tall)
TT X tt = 100% Tt (all tall)
Tt X Tt = 25% TT (tall), 50% Tt (tall), 25% tt (short)
tt X tt = 100% tt (short)
Note that if there is a T present in the genotype (TT or Tt), that individual will be tall. The only way to produce short offspring is for the both parents to have a copy of the short allele (t).
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)