1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
5

HELP ASAP!

Biology
2 answers:
fgiga [73]3 years ago
5 0

Answer:

dinural

Explanation:

only 1 high / low tide a day

Delicious77 [7]3 years ago
4 0
The answer is
SEMI-DINURAL
You might be interested in
Please explain plant reproduction
Levart [38]

Plant reproduction is the production of new offspring in plants, which can be accomplished by sexual or asexual reproduction. Sexual reproduction produces offspring by the fusion of gametes, resulting in offspring genetically different from the parent or parents.

5 0
3 years ago
Read 2 more answers
A sodium-potassium pump within a cell membrane requires energy to move sodium and potassium ions into or out of a cell. The move
Anna71 [15]
The correct answer is: Sodium and potassium ions move by active transport, and glucose moves by facilitated diffusion.

Because sodium and potassium are moved through cell membrane against their concentration gradients, transport requires energy (ATP), so it is active. <span>Glucose is a polar molecule and because the plasma membrane is impermeable to polar molecules transport of this important nutrient is accomplished by carrier proteins. This process is called facilitated diffusion and it is passive transport (doesn’t require energy).</span>
7 0
3 years ago
Evidence of evolution includes
BartSMP [9]

Answer: There are five lines of evidence that support evolution: the fossil record, biogeography, comparative anatomy, comparative embryology, and molecular biology

3 0
3 years ago
Read 2 more answers
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Which type of metamorphism usually produces non-foliated rocks?
Tresset [83]
Regional is the answer
4 0
4 years ago
Other questions:
  • Which white blood cells function primarily as phagocytotic cells?
    10·1 answer
  • 1. Lynn is a 2-year-old girl. Her mom and she like to play a game where her mom pretends to
    13·1 answer
  • Help me with this please
    7·2 answers
  • Other than passing genes from parents to offspring, bacteria are also capable of injecting their genes directly into other bacte
    15·1 answer
  • Bacteria come in assorted colors due to _____.
    12·2 answers
  • What organelle is responsible for energy production
    8·2 answers
  • How can high temperature lead to death
    13·2 answers
  • Why do third level consumers gain was energy from their food
    12·2 answers
  • examine the chart outlining cell structure and cellular functions for five cell types which explanation describes the comparison
    6·2 answers
  • Select the correct answer.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!