Plant reproduction is the production of new offspring in plants, which can be accomplished by sexual or asexual reproduction. Sexual reproduction produces offspring by the fusion of gametes, resulting in offspring genetically different from the parent or parents.
The correct answer is: Sodium and potassium ions move by active transport, and glucose moves by facilitated diffusion.
Because sodium and potassium are moved through cell membrane against their concentration gradients, transport requires energy (ATP), so it is active. <span>Glucose is a polar molecule and because the plasma membrane is impermeable to polar molecules transport of this important nutrient is accomplished by carrier proteins. This process is called facilitated diffusion and it is passive transport (doesn’t require energy).</span>
Answer: There are five lines of evidence that support evolution: the fossil record, biogeography, comparative anatomy, comparative embryology, and molecular biology
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
