Answer: Some sticklebacks were stranded in lakes that were formed in the ice age
Answer:
A. Plants will only flower during long day periods when the day length exceeds their necessary photoperiod
Explanation:
Photoperiodism is a phenomenon that refers to the response of an organism to the length of day. This phenomenon causes a physiological change in the organisms involved (plants or animals). However, the best studied example of change caused by photoperiodism is that of FLOWERING IN PLANTS.
Different plants flower at different times in response to the day length. Certain plants called LONG DAY PLANTS e.g. spinach and potato etc only flower when the length of day exceeds their photoperiod (threshold), which is usually 12 hours. These plants require very short periods of darkness to flower.
Hence, according to the question, FLOWERING response in plants is the best explanation to describe photoperiodism.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation: