Out of all the options, only "Volcanic Eruption" is the rapid change
In short, Your Answer would be Option D
Hope this helps!
Answer:
There are no options to this question, however, the question can be answered. The answer is:
FF and FF/Ff
Explanation:
This question involves a single gene coding for possession or not of freckles in humans. The allele for freckles (F) is dominant over the allele for no freckles (f). This means that genotypes FF and Ff (heterozygous) will possess freckles while only genotype ff will not.
According to this question, a couple has several children in which all of the children have freckles i.e. have either genotype FF or Ff. This is as a result of the fact that the parent's genotypes were either FF or Ff. That is, one parent is FF while the other is either FF or Ff. This genotypes will only produce children with freckles.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
Answer:
prokaryotes
Explanation:
prokaryotes where the earliest life forms ,simple creatures that fed on carbon compounds that were accumulating an Earth's early.slowly other organisms evolve that use the sun's energy along with compounds such as sulfides to generate their own energy.
