1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
15

draw a labelled diagram of the condition of one of the vegetable cells after being immersed in the concentrated salt solution fo

r 30 minutes.​

Biology
1 answer:
Alex73 [517]3 years ago
8 0

And I hope this helps! and don't care about those colours that's just printing fault.

You might be interested in
Write a hypothesis about the effect of dry conditions on earthworm behavior. Use the "if . . . then . . . because . . .” format,
barxatty [35]

Answer:

If the earthworm external stimuli is affected, then the behavior would change because earthworms react negatively to odors.

5 0
3 years ago
'Ophelia' is the Natural satellites of which planet in our solar system?
ss7ja [257]

Answer:

Uranus

Explanation:

I hope this helps

6 0
3 years ago
11. Which statement fits the heliocentric model of the solar system?
Umnica [9.8K]

Answer:

The Sun revolves around Earth.

5 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Scientists are not finding a diverse population of organisms on the coral reefs in the Bashamas why
NeTakaya

Answer: Because of pollution and overfishing

4 0
3 years ago
Other questions:
  • ________ believed that use (or lack of use) of body parts enables individual to develop certain traits that it passes on to its
    8·1 answer
  • Making a water cycle model
    13·1 answer
  • What is called when plants lose water through their leaves?
    8·1 answer
  • A stimulus type that occurs within the organisms body is
    10·1 answer
  • ABC
    8·1 answer
  • One job of the kidneys is to
    10·1 answer
  • What is the complementary strand for the DNA sequence below? TAC CAG CCA
    5·1 answer
  • How does the sound from a bass guitar compare to the sound from a whistle? A. The bass guitar has longer wavelengths than the wh
    10·1 answer
  • Relative dating techniques have been around for hundreds of years. How did newer
    10·1 answer
  • Help please ASAP I need this answer
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!