1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sveta_85 [38]
3 years ago
10

When two pink flowers (rw) are crossed, there are four equally likely possible outcomes for the genetic makeup of the offspring:

red (rr), pink (rw), pink (wr), and white (ww). complete the punnett square. if two pink flowers are crossed, what is the probability that the offspring is?
Biology
2 answers:
My name is Ann [436]3 years ago
6 0
Punnet square
        
                                                         Pink flower x pink  flower
                                                                  rw                    rw
F1 generation
                                                                      rr, rw, rw, ww
Probability
                            red flower (rr)     = 1
                            pink flower (rw)  = 2
                            wite flower (ww) = 1


elena55 [62]3 years ago
3 0

1 red

2 pink

1 white

please rate and thank :)

You might be interested in
Match the given symbol or molecular formula to the term that best describes it. SO2 K Cl2 C6H6 element arrowRight organic compou
kramer

Answer:

C6H6 - organic compound

K - element

Cl2 - inorganic elemental molecule

SO2 -  inorganic compound

Explanation:

An organic compound contains carbon and hydrogen bonded covalently . Sometimes other atoms aside from carbon and hydrogen called heteroatoms are also found in organic compounds. C6H6 is an organic compound.

Elements are found in periodic table. They always occur in uncombined state. K is an element.

Cl2 is an inorganic elemental molecule containing two chlorine atoms bonded covalently.

SO2 is an inorganic compound composed of sulphur and oxygen bound covalently. Mnay inorganic compounds do not contain carbon

9 0
3 years ago
Read 2 more answers
What are three terms that are used to describe organisms such as Skyhawks
anzhelika [568]
Heterotrophs, tertiary consumers and top carnivores.
3 0
3 years ago
30 points<br> Can I get kept back for failing Horticulture? Yes No?<br> I currently have a 36
faltersainse [42]
It depends. if your grade a 36%?
4 0
3 years ago
Read 2 more answers
Argo is explaining coral feeding patterns to his daughter, specifically zooxanthellae interdependence. Which point should he exp
Yanka [14]

Answer:

to his daughter, specifically zooxanthellae interdependence

5 0
3 years ago
Equilibrium is when the concentration is the same throughout an entire system. Explain how a cell reaches equilibrium in all thr
Sati [7]

The cell reaches equilibrium in a hypertonic solution by removing water from it so that the two concentrations are isotonic, in a hypotonic solution the water will move into the cell and in an isotonic solution the water will not move anywhere anymore. Both cells have the same solute concentration.

<h3>How do these equilibrium processes occur?</h3>

The hypertonic solution is the one that has a solute concentration greater than that of the cell, so in order to reach the same concentration, the water in the cell will leave to equal the solute concentration in the cell. The hypotonic solution, on the other hand, is the one that has a lower solute concentration than the cell, so the water will enter the cell to have the same concentration.

Finally in the isotonic solution nothing will happen, since both inside the cell and in the solution itself there will be the same concentration of solute, so no concentration has to be equalized.

Therefore, we can confirm that the cell reaches equilibrium in a hypertonic solution by removing water from it so that the two concentrations are isotonic, in a hypotonic solution the water will move into the cell and in an isotonic solution the water will not move anywhere anymore. Both cells have the same solute concentration.

To learn more about solutions visit: brainly.com/question/7932885

#SPJ1

6 0
1 year ago
Other questions:
  • Low frequency diseases can be exclusively covered by what kind of health insurance policies
    6·1 answer
  • Your patient has suffered a severe electrical burn. when caring for electrical burn​ injuries, you should​ never:
    12·1 answer
  • What minerals play a role in healthy bone growth and maintenance?
    11·1 answer
  • Rose bushes usually rebloom from year to year. Roses, therefore, would be considered
    6·2 answers
  • Who came up with the idea of natural selection
    15·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following statements about extinction is true? Choose one: A. Recent species are disappearing so slowly that resear
    10·1 answer
  • The traits of the offspring are the
    6·1 answer
  • Quaternary consumers are not _______. a. consumers b. prey c. predators d. animals
    12·1 answer
  • What is the location in the cell of anaerobic respiration?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!